Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HAND1-heart and neural crest derivatives expressed 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HAND1-heart and neural crest derivatives expressed 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021190 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HAND1 |
| Origin species: | Human |
| Product name: | HAND1-heart and neural crest derivatives expressed 1 Gene |
| Size: | 2ug |
| Accessions: | BC021190 |
| Gene id: | 9421 |
| Gene description: | heart and neural crest derivatives expressed 1 |
| Synonyms: | Hxt; Thing1; bHLHa27; eHand; heart- and neural crest derivatives-expressed protein 1; class A basic helix-loop-helix protein 27; extraembryonic tissues, heart, autonomic nervous system and neural crest derivatives-expressed protein 1; heart and neural crest derivatives expressed 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacctcgtgggcagctacgcacaccatcaccaccatcaccacccgcaccctgcgcaccccatgctccacgaacccttcctcttcggtccggcctcgcgctgtcatcaggaaaggccctacttccagagctggctgctgagcccggctgacgctgccccggacttccctgcgggcgggccgccgcccgcggccgctgcagccgccaccgcctatggtcctgacgccaggcctgggcagagccccgggcggctggaggcgcttggcggccgtcttggccggcggaaaggctcaggacccaagaaggagcggagacgcactgagagcattaacagcgcattcgcggagttgcgcgagtgcatccccaacgtgccggccgacaccaagctctccaagatcaagactctgcgcctagccaccagctacatcgcctacctgatggacgtgctggccaaggatgcacagtctggcgatcccgaggccttcaaggctgaactcaagaaggcggatggcggccgtgagagcaagcggaaaagggagctgcagcagcacgaaggttttcctcctgccctgggcccagtcgagaagaggattaaaggacgcaccggctggccgcagcaagtctgggcgctggagttaaaccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - myeloid cell leukemia sequence 1 (BCL2-related) - DnaJ (Hsp40) homolog, subfamily C, member 30 - defects in morphology 1 homolog (S. cerevisiae) - cell division cycle 16 homolog (S. cerevisiae) |