Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of POU2AF1-POU class 2 associating factor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POU2AF1-POU class 2 associating factor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032549 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POU2AF1 |
| Origin species: | Human |
| Product name: | POU2AF1-POU class 2 associating factor 1 Gene |
| Size: | 2ug |
| Accessions: | BC032549 |
| Gene id: | 5450 |
| Gene description: | POU class 2 associating factor 1 |
| Synonyms: | BOB1; OBF-1; OBF1; OCAB; POU domain class 2-associating factor 1; B-cell-specific coactivator OBF-1; BOB-1; OCA-B; OCT-binding factor 1; POU class 2 associating factor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctctggcaaaaacccacagctccggagcaagccccagccccggcccggccataccagggcgtccgtgtgaaggagccagtgaaggaactgctgaggaggaagcgaggccacgccagcagtggggcagcacctgcacctacggcggtggtgctgccccatcagcccctggcgacctacaccacagtgggtccttcctgcctggacatggaaggttctgtgtctgcagtgacagaggaggctgccctgtgtgccggctggctctcccagcccaccccggccaccctgcagcccctggccccatggacaccttacaccgagtatgtgccccatgaagctgtcagctgcccctactcagctgacatgtatgtgcagcccgtgtgccccagctacacggtggtggggccctcctcagtgttgacctatgcctctccgccactcatcaccaatgtcacgacaagaagctccgccacgcccgcagtggggcccccgctggagggcccagagcaccaggcacccctcacctatttcccgtggcctcagcccctttccacactacccacctccaccctgcagtaccagcctccggccccagccctacctgggccccagtttgtccagctccccatctctatcccagagccagtccttcaggacatggaagaccccagaagagccgccagctcgttgaccatcgacaagctgcttttggaggaagaggatagcgacgcctatgcgcttaaccacactctctctgtggaaggcttttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - left-right determination factor 1 - zinc finger, BED-type containing 2 - interleukin 13 receptor, alpha 1 - coenzyme Q4 homolog (S. cerevisiae) |