PTXBC017492
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix | 
| Product type | DNA & cDNA | 
| Origin species | Human | 
| Brand: | ProteoGenix | 
| Proteogenix catalog: | PTXBC017492 | 
| Product type: | DNA & cDNA | 
| Ncbi symbol: | COG8 | 
| Origin species: | Human | 
| Product name: | COG8-component of oligomeric golgi complex 8 Gene | 
| Size: | 2ug | 
| Accessions: | BC017492 | 
| Gene id: | 84342 | 
| Gene description: | component of oligomeric golgi complex 8 | 
| Synonyms: | CDG2H; DOR1; conserved oligomeric Golgi complex subunit 8; COG complex subunit 8; conserved oligomeric golgi complex component 8; dependent on RIC1; component of oligomeric golgi complex 8 | 
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG | 
| Orf sequence: | atgaactcctacatgctcatctcggctccagccatcctgggcaccagtaacatgcctgctgctgtgccagccacccagccggggacgctgcagccacccatggtgctcctagatttcccacccctcgcctgctttctcaacaatattctggttgccttcaatgatctgcgcctctgctgccctgtggccctggcgcaggatgtgactggggccttggaagatgcccttgccaaggtaactaaaataatcctggccttccatcgcgctgaagaggctgccttcagcagcggggagcaagagctctttgtccagttctgcactgtcttcctggaagaccttgttccgtatttaaatcgctgtctccaagtcctttttccaccagctcagatagcacagactttaggcattcctcccactcagctctccaagtacggtaacctagggcatgtgaacatcggcgccattcaggagcccctcgcctttatcctgccaaagagagagacgcttttcaccctggatgaccaggcgctggggcccgagctcacagctccagcaccagagcctcccgccgaggagccacgcctggagcccgcgggcccagcctgcccggagggagggcgagcggagacgcaggccgaaccgcccagcgtggggccctag | 
| Vector: | pDONR223 | 
| Delivery lead time in business days in europe: | 10-12 days | 
| Storage: | -20â | 
| Delivery condition: | Blue Ice | 
| Related products: | - chromosome 1 open reading frame 105 - chromosome 11 open reading frame 57 - chromosome 19 open reading frame 66 - chromosome 21 open reading frame 70  |