PTXBC017492
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017492 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COG8 |
| Origin species: | Human |
| Product name: | COG8-component of oligomeric golgi complex 8 Gene |
| Size: | 2ug |
| Accessions: | BC017492 |
| Gene id: | 84342 |
| Gene description: | component of oligomeric golgi complex 8 |
| Synonyms: | CDG2H; DOR1; conserved oligomeric Golgi complex subunit 8; COG complex subunit 8; conserved oligomeric golgi complex component 8; dependent on RIC1; component of oligomeric golgi complex 8 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaactcctacatgctcatctcggctccagccatcctgggcaccagtaacatgcctgctgctgtgccagccacccagccggggacgctgcagccacccatggtgctcctagatttcccacccctcgcctgctttctcaacaatattctggttgccttcaatgatctgcgcctctgctgccctgtggccctggcgcaggatgtgactggggccttggaagatgcccttgccaaggtaactaaaataatcctggccttccatcgcgctgaagaggctgccttcagcagcggggagcaagagctctttgtccagttctgcactgtcttcctggaagaccttgttccgtatttaaatcgctgtctccaagtcctttttccaccagctcagatagcacagactttaggcattcctcccactcagctctccaagtacggtaacctagggcatgtgaacatcggcgccattcaggagcccctcgcctttatcctgccaaagagagagacgcttttcaccctggatgaccaggcgctggggcccgagctcacagctccagcaccagagcctcccgccgaggagccacgcctggagcccgcgggcccagcctgcccggagggagggcgagcggagacgcaggccgaaccgcccagcgtggggccctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 1 open reading frame 105 - chromosome 11 open reading frame 57 - chromosome 19 open reading frame 66 - chromosome 21 open reading frame 70 |