Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RICH2-Rho-type GTPase-activating protein RICH2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RICH2-Rho-type GTPase-activating protein RICH2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022452 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RICH2 |
| Origin species: | Human |
| Product name: | RICH2-Rho-type GTPase-activating protein RICH2 Gene |
| Size: | 2ug |
| Accessions: | BC022452 |
| Gene id: | 9912 |
| Gene description: | Rho-type GTPase-activating protein RICH2 |
| Synonyms: | rho GTPase-activating protein RICH2; Rho-type GTPase-activating protein RICH2; RICH2; NPC-A-10; rho GTPase-activating protein 44; RhoGAP interacting with CIP4 homologs protein 2; Rho GTPase activating protein 44 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagaccagtccgctggccagccgtccccagtcagcctgtcccccaccccgcccagcaccccgtcaccctatggactgagctaccctcaggggtactccttggcctcgggccagctctccccagctgcagctcctcccctggcctctccttctgtctttacaagcactttgagcaaatcgcggcccactcctaagccgcgacagagacctactctgccgcctcctcagcctcccacagtaaacctctcggcctctagtccacagtccacggaggcccccatgctagatggcatgtcccctggggaaagcatgtctacagctgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 20 open reading frame 196 - pyridoxal (pyridoxine, vitamin B6) kinase - chromosome 14 open reading frame 100 - zinc finger, FYVE domain containing 19 |