Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HMGN4-high mobility group nucleosomal binding domain 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HMGN4-high mobility group nucleosomal binding domain 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001282 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HMGN4 |
| Origin species: | Human |
| Product name: | HMGN4-high mobility group nucleosomal binding domain 4 Gene |
| Size: | 2ug |
| Accessions: | BC001282 |
| Gene id: | 10473 |
| Gene description: | high mobility group nucleosomal binding domain 4 |
| Synonyms: | HMG17L3; NHC; high mobility group nucleosome-binding domain-containing protein 4; high mobility group protein N4; high-mobility group (nonhistone chromosomal) protein 17-like 3; high-mobility group protein 17-like 3; non-histone chromosomal protein HMG-17-like 3; high mobility group nucleosomal binding domain 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccaagagaaaggcaaaaggagatgctaaaggtgataaagcaaaggtgaaggatgagccacagaggagatcagctcggttgtctgctaaaccagctcctccaaaaccagagcccaggcctaaaaaggcctctgcaaagaagggagagaagcttcccaaagggagaaaggggaaagcagatgctggaaaggatggaaacaaccctgcaaaaaaccgagatgcctctacactccagtcccagaaagcggaaggcactggggatgccaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hepatoma-derived growth factor-related protein 2 - Rho guanine nucleotide exchange factor (GEF) 1 - nuclear assembly factor 1 homolog (S. cerevisiae) - zinc finger, DHHC-type containing 8 pseudogene |