Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NLRP1-NLR family, pyrin domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NLRP1-NLR family, pyrin domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016965 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NLRP1 |
| Origin species: | Human |
| Product name: | NLRP1-NLR family, pyrin domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC016965 |
| Gene id: | 22861 |
| Gene description: | NLR family, pyrin domain containing 1 |
| Synonyms: | CARD7; CIDED; CLR17.1; DEFCAP; DEFCAP-L/S; NAC; NALP1; PP1044; SLEV1; VAMAS1; NACHT, LRR and PYD domains-containing protein 1; NACHT, LRR and PYD containing protein 1; NACHT, leucine rich repeat and PYD (pyrin domain) containing 1; NACHT, leucine rich repeat and PYD containing 1; caspase recruitment domain protein 7; caspase recruitment domain-containing protein 7; death effector filament-forming Ced-4-like apoptosis protein; nucleotide-binding domain and caspase recruitment domain; nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1; NLR family pyrin domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccctggacccctaccactctgtgacgtgggggcacgcgcagggatcccatcattttgtgtttggggagctcagagtgcgcccaatcttggaatctttaagggatgagccagacccagacccgcggccttctagagagggtccggcagggagggtcggcgccctggcccggggtgggccggagccctgtgatgctgcatcgcccccaggaggagccagctgtgccccagagttggcgcggccgagagaggacaagagcgcgcagcaggcgaagctggagggcgggactcgactttgttgtcgctgcccggaggagtcgagactggtacccggaggagctgtctcaccaggagaccacgtcctggaagtgtccgggactcgcgggacctgtggctgcagaccccgccggcacgcaggcccagagctggcgcactcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - single-stranded DNA binding protein 1 - phenylethanolamine N-methyltransferase - hydroxyacylglutathione hydrolase-like - acetyl-Coenzyme A acetyltransferase 2 |