Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IL8-interleukin 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL8-interleukin 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013615 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL8 |
| Origin species: | Human |
| Product name: | IL8-interleukin 8 Gene |
| Size: | 2ug |
| Accessions: | BC013615 |
| Gene id: | 3576 |
| Gene description: | interleukin 8 |
| Synonyms: | IL8; GCP-1; GCP1; LECT; LUCT; LYNAP; MDNCF; MONAP; NAF; NAP-1; NAP1; interleukin-8; T-cell chemotactic factor; alveolar macrophage chemotactic factor I; beta endothelial cell-derived neutrophil activating peptide; beta-thromboglobulin-like protein; chemokine (C-X-C motif) ligand 8; emoctakin; granulocyte chemotactic protein 1; interleukin 8; lung giant cell carcinoma-derived chemotactic protein; lymphocyte derived neutrophil activating peptide; monocyte-derived neutrophil chemotactic factor; monocyte-derived neutrophil-activating peptide; neutrophil-activating peptide 1; small inducible cytokine subfamily B, member 8; tumor necrosis factor-induced gene 1; C-X-C motif chemokine ligand 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacttccaagctggccgtggctctcttggcagccttcctgatttctgcagctctgtgtgaaggtgcagttttgccaaggagtgctaaagaacttagatgtcagtgcataaagacatactccaaacctttccaccccaaatttatcaaagaactgagagtgattgagagtggaccacactgcgccaacacagaaattattgtaaagctttctgatggaagagagctctgtctggaccccaaggaaaactgggtgcagagggttgtggagaagtttttgaagagggctgagaattcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - homeobox B7 - KCNE1-like - gametogenetin - KIAA0196 |