Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HACL1-2-hydroxyacyl-CoA lyase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HACL1-2-hydroxyacyl-CoA lyase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007440 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HACL1 |
| Origin species: | Human |
| Product name: | HACL1-2-hydroxyacyl-CoA lyase 1 Gene |
| Size: | 2ug |
| Accessions: | BC007440 |
| Gene id: | 26061 |
| Gene description: | 2-hydroxyacyl-CoA lyase 1 |
| Synonyms: | 2-HPCL; HPCL; HPCL2; PHYH2; 2-hydroxyacyl-CoA lyase 1; 1600020H07Rik; 2-hydroxyphytanol-CoA lyase; 2-hydroxyphytanoyl-CoA lyase; phytanoyl-CoA 2-hydroxylase 2; phytanoyl-CoA hydroxylase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggacagtaacttcgcagagcgcagcgaggagcaggtgtctggtgctaaagtcatcgctcaggccctgaaaacgcaagatgtggagtacatatttggcatcgtaggcatcccagtgaccgaaatcgccattgctgcccagcagctaggcatcaagtacatcgggatgaggaatgagcaagcggcttgttatgctgcctccgcgattggatatctgacaagcaggccaggagtctgccttgttgtttctggcccaggtctcatccatgccttgggcggtatggcaaatgcaaacatgaactgctggttgaagcttgtagattatataccaagttctctgcccgcccaagcagcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - E2F transcription factor 3 - SH2 domain containing 3C - tubulin folding cofactor D - ligand of numb-protein X 2 |