Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of OPRS1-opioid receptor, sigma 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OPRS1-opioid receptor, sigma 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007839 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OPRS1 |
| Origin species: | Human |
| Product name: | OPRS1-opioid receptor, sigma 1 Gene |
| Size: | 2ug |
| Accessions: | BC007839 |
| Gene id: | 10280 |
| Gene description: | opioid receptor, sigma 1 |
| Synonyms: | OPRS1; ALS16; DSMA2; SIG-1R; SR-BP; SR-BP1; SRBP; hSigmaR1; sigma1R; sigma non-opioid intracellular receptor 1; SR31747 binding protein 1; aging-associated gene 8 protein; sigma 1-type opioid receptor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagtgggccgtgggccggcggtgggcgtgggccgcgctgctcctggctgtcgcagcggtgctgacccaggtcgtctggctctggctgggtacgcagagcttcgtcttccagcgcgaagagatagcgcagttggcgcggcagtacgctgggctggaccacgagctggccttctctcgtctgatcgtggagctgcggcggctgcacccaggccacgtgctgcccgacgaggagctgcagtgggtgttcgtgaatgcgggtggctggatgggcgccatgtgccttctgcacgcctcgctgtccgaggcgctactgggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tectonic family member 3 - zinc finger protein 774 - zinc finger protein 219 - Opa interacting protein 5 |