Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of EHBP1-EH domain binding protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EHBP1-EH domain binding protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029477 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EHBP1 |
| Origin species: | Human |
| Product name: | EHBP1-EH domain binding protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC029477 |
| Gene id: | 23301 |
| Gene description: | EH domain binding protein 1 |
| Synonyms: | HPC12; NACSIN; EH domain-binding protein 1; NPF calponin-like protein; testis tissue sperm-binding protein Li 50e; EH domain binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttcagtttggaagagactgcagcgtgtgggaaaacatgcatccaagttccagtttgtggcctcctaccaggagctcatggttgagtgtacgaagaaatggcaaccagataaactggtggtagtttggaccagaagaagccgaaggaagtcttctaaggcacatagctggcaacctggaataaaaaatccctatcgtggtgttgttgtgtggcctgttcctgaaaacattgaaatcactgtaacactttttaaggatcctcatgcggaagaatttgaagacaaagagtggacatttgtcatagaaaatgtaagctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 39A - kelch-like 36 (Drosophila) - transmembrane protein 196 - ancient ubiquitous protein 1 |