Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PTPN11-protein tyrosine phosphatase, non-receptor type 11 Gene
PTXBC025181
New product
Data sheet of PTPN11-protein tyrosine phosphatase, non-receptor type 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTPN11-protein tyrosine phosphatase, non-receptor type 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025181 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTPN11 |
| Origin species: | Human |
| Product name: | PTPN11-protein tyrosine phosphatase, non-receptor type 11 Gene |
| Size: | 2ug |
| Accessions: | BC025181 |
| Gene id: | 5781 |
| Gene description: | protein tyrosine phosphatase, non-receptor type 11 |
| Synonyms: | BPTP3; CFC; JMML; METCDS; NS1; PTP-1D; PTP2C; SH-PTP2; SH-PTP3; SHP2; tyrosine-protein phosphatase non-receptor type 11; PTP-2C; protein-tyrosine phosphatase 1D; protein-tyrosine phosphatase 2C; protein tyrosine phosphatase, non-receptor type 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgcttggtaaaaggtgatcgcaggttctcagacgagtttactttacatgagatggaatcaggcagagaggctgggatgatggagaaagctcgaggtgaagttttaaaaaaaaagttgtggaaaggaaagttccaaagaggtggtttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phospholipase C, beta 1 (phosphoinositide-specific) - ATPase, H+ transporting, lysosomal V0 subunit a2 - vacuolar protein sorting 54 homolog (S. cerevisiae) - ATP-binding cassette, sub-family E (OABP), member 1 |