Cart 9 Product Products 1 867,80 € (empty)
-
1 x TSC22D3-TS...113,40 € -
1 x HIST2H2BE-...113,40 € -
-
1 x SHE-Src...121,50 € -
-
-
1 x ABI2-abl...121,50 € -
-
No products
To be determined Shipping
1 867,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 867,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 867,80 €
Data sheet of GPR89A-G protein-coupled receptor 89A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR89A-G protein-coupled receptor 89A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC067816 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR89A |
| Origin species: | Human |
| Product name: | GPR89A-G protein-coupled receptor 89A Gene |
| Size: | 2ug |
| Accessions: | BC067816 |
| Gene id: | 653519 |
| Gene description: | G protein-coupled receptor 89A |
| Synonyms: | GPHR; GPR89; GPR89B; SH120; UNQ192; Golgi pH regulator A; protein GPR89; G protein-coupled receptor 89A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtatttcttctggaaactaggagatccctttcccattctcagcccaaaacatgggatcttatccatagaacagctcatcagccgggttggtgtgattggagtgactctcatggctcttctttctggatttggtgctgtcaactgcccatacacttacatgtcttacttcctcaggaatgtgactgacacggatattctagccctggaacggcgactgctgcaaaccatggatatgatcataagcaaaaagaaaaggatggcaatggcacggagaacaatgttccagaagggggaagtgcataacaaaccatcaggtttctggggaatgataaaaagtgttaccacttcagcatcaggaagtgaaaatcttactcttattcaacaggaagtggatgctttggaagaattaagcaggcagctttttctggaaacagctgatctatatgctaccaaggagagaatagaatactccaaaaccttcaaggggaaatattttaattttcttggttactttttctctatttactgtgtttggaaaattttcatggctaccatcaatattgtttttgatcgagttgggaaaacggatcctgtcacaagaggcattgagatcactgtgaattatctgggaatccaatttgatgtgaagttttggtcccaacacatttccttcattcttgttggaataatcatcgtcacatccatcagaggattgctgatcactcttaccaagttcttttatgccatctctagcagtaagtcctccaatgtcattgtcctgctattagcacagataatgggcatgtactttgtctcctctgtgctgctgatccgaatgagtatgcctttagaataccgcaccataatcactgaagtccttggagaactgcagttcaacttctatcaccgttggtttgatgtgatcttcctggtcagcgctctctctagcatactcttcctctatttggctcacaaacaggcaccagagaagcaaatggcaccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - interleukin 10 receptor, alpha - signal recognition particle 9kDa - tripartite motif-containing 35 - exportin 1 (CRM1 homolog, yeast) |