FCRL2-Fc receptor-like 2 Gene View larger

FCRL2-Fc receptor-like 2 Gene

PTXBC069185

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FCRL2-Fc receptor-like 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FCRL2-Fc receptor-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC069185
Product type: DNA & cDNA
Ncbi symbol: FCRL2
Origin species: Human
Product name: FCRL2-Fc receptor-like 2 Gene
Size: 2ug
Accessions: BC069185
Gene id: 79368
Gene description: Fc receptor-like 2
Synonyms: CD307b; FCRH2; IFGP4; IRTA4; SPAP1; SPAP1A; SPAP1B; SPAP1C; Fc receptor-like protein 2; IFGP family protein 4; SH2 domain containing phosphatase anchor protein 1; fc receptor homolog 2; immune receptor translocation-associated protein 4; immunoglobulin receptor translocation-associated protein 4; immunoglobulin superfamily Fc receptor, gp42; Fc receptor like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctgtggtcattgctggtcatctttgatgcagtcactgaacaggcagattcgctgacccttgtggcgccctcttctgtcttcgaaggagacagcatcgttctgaaatgccagggagaacagaactggaaaattcagaagatggcttaccataaggataacaaagagttatctgttttcaaaaaattctcagatttccttatccaaagtgcagttttaagtgacagtggtaactatttctgtagtaccaaaggacaactctttctctgggataaaacttcaaatatagtaaagataaaagtccaaggacctgatggctatagaagagacctcatgacagctggagttctctggggactgtttggtgtccttggtttcactggtgttgctttgctgttgtatgccttgttccacaagatatcaggagaaagttctgccactaatgaacccagaggggcttccaggccaaatcctcaagagttcacctattcaagcccaaccccagacatggaggagctgcagccagtgtatgtcaatgcaaacatcaggacacttctggagaacaaggactcccaagtcatctactcttctgtgaagaaatcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tubulin, alpha 1b
- Rho family GTPase 1
- praja ring finger 2
- dystrobrevin, alpha

Reviews

Buy FCRL2-Fc receptor-like 2 Gene now

Add to cart