Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FCRL2-Fc receptor-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FCRL2-Fc receptor-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069185 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FCRL2 |
| Origin species: | Human |
| Product name: | FCRL2-Fc receptor-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC069185 |
| Gene id: | 79368 |
| Gene description: | Fc receptor-like 2 |
| Synonyms: | CD307b; FCRH2; IFGP4; IRTA4; SPAP1; SPAP1A; SPAP1B; SPAP1C; Fc receptor-like protein 2; IFGP family protein 4; SH2 domain containing phosphatase anchor protein 1; fc receptor homolog 2; immune receptor translocation-associated protein 4; immunoglobulin receptor translocation-associated protein 4; immunoglobulin superfamily Fc receptor, gp42; Fc receptor like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgctgtggtcattgctggtcatctttgatgcagtcactgaacaggcagattcgctgacccttgtggcgccctcttctgtcttcgaaggagacagcatcgttctgaaatgccagggagaacagaactggaaaattcagaagatggcttaccataaggataacaaagagttatctgttttcaaaaaattctcagatttccttatccaaagtgcagttttaagtgacagtggtaactatttctgtagtaccaaaggacaactctttctctgggataaaacttcaaatatagtaaagataaaagtccaaggacctgatggctatagaagagacctcatgacagctggagttctctggggactgtttggtgtccttggtttcactggtgttgctttgctgttgtatgccttgttccacaagatatcaggagaaagttctgccactaatgaacccagaggggcttccaggccaaatcctcaagagttcacctattcaagcccaaccccagacatggaggagctgcagccagtgtatgtcaatgcaaacatcaggacacttctggagaacaaggactcccaagtcatctactcttctgtgaagaaatcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tubulin, alpha 1b - Rho family GTPase 1 - praja ring finger 2 - dystrobrevin, alpha |