Cart 10 Product Products 1 039,16 € (empty)
-
1 x UTP3-UTP3,...121,50 € -
-
-
-
1 x RNF11-ring...113,40 € -
-
-
-
1 x CCDC108-co...113,40 € -
1 x Goat...119,00 €
No products
To be determined Shipping
1 039,16 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 039,16 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 039,16 €
Data sheet of TAPBP-TAP binding protein (tapasin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TAPBP-TAP binding protein (tapasin) Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC080574 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TAPBP |
| Origin species: | Human |
| Product name: | TAPBP-TAP binding protein (tapasin) Gene |
| Size: | 2ug |
| Accessions: | BC080574 |
| Gene id: | 6892 |
| Gene description: | TAP binding protein (tapasin) |
| Synonyms: | NGS17; TAPA; TPN; TPSN; NGS-17; TAP binding protein (tapasin); TAP-associated protein; TAP binding protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagtccctgtctctgctcctcgctgtggctttgggcctggcgaccgccgtctcagcaggacccgcggtgatcgagtgttggttcgtggaggatgcgagcggaaagggcctggccaagagacccggtgcactgctgttgcgccagggaccgggggaaccgccgccccggccggacctcgaccctgagctctatctcagtgtacacgaccccgcgggcgccctccaggctgccttcaggcggtatccccggggcgcccccgcaccacactgcgagatgagccgcttcgtgcctctccccgcctctgcgaaatgggccagcggcctgacccccgcgcagaactgcccgcgggccctggatggggcttggctgatggtcagcatatccagcccagtcctcagcctctccagcctcttgcgaccacagccagagcctcagcaggagcctgttctcatcaccatggcaacagtggtactgactgtcctcacccacacccctgcccctcgagtgagactgggacaagatgctctgctggacttgagctttgcctacatgccccccacctccgaggccgcctcatctctggctccgggtccccctccctttgggctagagtggcgacgccagcacctgggtaagggacatctgctcctggctgcaactcctgggctgaatggccagatgccagcagcccaagaaggggccgtggcatttgctgcttgggatgatgatgagccatggggcccatggaccggaaatgggaccttctggctgcctagagttcaaccctttcaggagggcacctatctggccaccatatacctgccatacctgcaaggacaggtcaccctggagcttgctgtgtacaaaccccccaaagtgtccctgatgccagcaacccttgcacgggccgccccaggggaggcacccccggaattgctctgccttgtgtcccacttctacccttctgggggcctggaggtggagtgggaactccggggtggcccagggggccgctctcagaaggccgaggggcagaggtggctctcggccctgcgccaccattccgatggctctgtcagcctctctgggcacttgcagccgcccccagtcaccactgagcagcatggggcacgctatgcctgtcgaattcaccatcccagcctgcctgcctcggggcgcagcgctgaggtcaccctggaggtagcaggtctttcagggccctcccttgaggacagcgtaggccttttcctgtctgcctttcttctgcttgggctcttcaaggcactgggctgggctgctgtctacctgtccacctgcaaggattcaaagaaggtacagtgctccacctctctgtatctttcccttgtcactttatctcctcatcctatctcaaaacccatggagggaggctgctggtgtggtaggcagaacctaggcttggaattcacactgatctgggttaaaacctggcactatatcctaactgtaggactctttgagcatgctacttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pre-B-cell leukemia homeobox 2 - complement factor H-related 3 - G protein-coupled receptor 82 - kallikrein-related peptidase 4 |