Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HSD17B7P2-hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2 Gene
PTXBC071987
New product
Data sheet of HSD17B7P2-hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HSD17B7P2-hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC071987 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HSD17B7P2 |
| Origin species: | Human |
| Product name: | HSD17B7P2-hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2 Gene |
| Size: | 2ug |
| Accessions: | BC071987 |
| Gene id: | 158160 |
| Gene description: | hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgaaaggtggttttgattaccggggctagcagtggcattggcctggccctctgcaagcggctgctggcggaagatgatgagcttcatctgtgtttggcgtgcaggaatatgagcaaggcagaagctgtctgtgctgctctgctggcctctcaccccactgctgaggtcaccattgtccaggtggatgtcagcaacctgcagtcattcttccgggcctccaaggaacttaagcaaagttgcaggtttcagagattagaccgtatatatctaaatgctgggatcatgcctaatccacaactaaatatcaaagcacttctctttggcctcttttcaagaaaagtgattcatatgttctccacagctgaaggcctgctgacccagggtgataagatcactgctgatggacttcaggaggtgtttgagaccgatgtctttggccattttatcctgattcgggaactggagcctctcctctgtcacagtgacaatccatctcagctcatctggacatcatctcgcaatgcaaggaaatctaatttcagcctcgaggacttccagcacagcaaaggcaaggaaccctacagctcttccaaatatgccactgaccttttgagtgtggctttgaacaggaactttcaaccagcagcttcgcttttttgcaaatgcattcactttgacaccatataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa - sterol regulatory element binding transcription factor 1 - transmembrane emp24 protein transport domain containing 4 - protein kinase, AMP-activated, alpha 2 catalytic subunit |