Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of NPHP3-nephronophthisis 3 (adolescent) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NPHP3-nephronophthisis 3 (adolescent) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC068082 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NPHP3 |
| Origin species: | Human |
| Product name: | NPHP3-nephronophthisis 3 (adolescent) Gene |
| Size: | 2ug |
| Accessions: | BC068082 |
| Gene id: | 27031 |
| Gene description: | nephronophthisis 3 (adolescent) |
| Synonyms: | CFAP31; MKS7; NPH3; RHPD; RHPD1; SLSN3; nephrocystin-3; Meckel syndrome, type 7; cilia and flagella associated protein 31; nephronophthisis 3 (adolescent); nephrocystin 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggaccgcctcgtcgctcgtgagccccgcgggcggggaagtgatcgaggacacgtacggggcgggcggcggcgaggcctgcgagatcccggtggaggtgaagcccaaggcccgcctgctgcgcaactcgttccgccgaggcgcgggggcggcagcaggggccgggcccgggtcgctgccccgcggggtgggcgcgggcgggctgctgggggccagcttcaagtccactggctcgtcggtgccagagctggagtacgcggcggccgagtacgagcggctcaggaaggagtacgagatctttcgcgtcagcaagaaccaggagttgttgtccatgggccgccgcgaggccaagctggacacggagaacaagcggctgcgggccgaactgcagggtctcgctgcggtggcacgatcgcggctcactgcaacctggaactcctgggctcaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chemokine (C-C motif) receptor 4 - Wilms tumor 1 associated protein - exonuclease 3'-5' domain-like 1 - signal-regulatory protein gamma |