NRG1-neuregulin 1 Gene View larger

NRG1-neuregulin 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NRG1-neuregulin 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NRG1-neuregulin 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006492
Product type: DNA & cDNA
Ncbi symbol: NRG1
Origin species: Human
Product name: NRG1-neuregulin 1 Gene
Size: 2ug
Accessions: BC006492
Gene id: 3084
Gene description: neuregulin 1
Synonyms: pro-NRG1; NRG1-IT2; ARIA; GGF; GGF2; HGL; HRG; HRG1; HRGA; MST131; MSTP131; NDF; SMDF; pro-neuregulin-1, membrane-bound isoform; acetylcholine receptor-inducing activity; glial growth factor 2; heregulin, alpha (45kD, ERBB2 p185-activator); neu differentiation factor; sensory and motor neuron derived factor; neuregulin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgagcgcaaagaaggcagaggcaaagggaagggcaagaagaaggagcgaggctccggcaagaagccggagtccgcggcgggcagccagagcccagccttgcctccccaattgaaagagatgaaaagccaggaatcggctgcaggttccaaactagtccttcggtgtgaaaccagttctgaatactcctctctcagattcaagtggttcaagaatgggaatgaattgaatcgaaaaaacaaaccacaaaatatcaagatacaaaaaaagccagggaagtcagaacttcgcattaacaaagcatcactggctgattctggagagtatatgtgcaaagtgatcagcaaattaggaaatgacagtgcctctgccaatatcaccatcgtggaatcaaacgagatcatcactggtatgccagcctcaactgaaggagcatatgtgtcttcagagtctcccattagaatatcagtatccacagaaggagcaaatacttcttcatctacatctacatccaccactgggacaagccatcttgtaaaatgtgcggagaaggagaaaactttctgtgtgaatggaggggagtgcttcatggtgaaagacctttcaaacccctcgagatacttgtgcaagtgcccaaatgagtttactggtgatcgctgccaaaactacgtaatggccagcttctacagtacgtccactccctttctgtctctgcctgaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - KIAA0467
- KIAA0195
- neurensin 2
- syntaxin 17

Buy NRG1-neuregulin 1 Gene now

Add to cart