ADAM17-ADAM metallopeptidase domain 17 Gene View larger

ADAM17-ADAM metallopeptidase domain 17 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ADAM17-ADAM metallopeptidase domain 17 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ADAM17-ADAM metallopeptidase domain 17 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC062687
Product type: DNA & cDNA
Ncbi symbol: ADAM17
Origin species: Human
Product name: ADAM17-ADAM metallopeptidase domain 17 Gene
Size: 2ug
Accessions: BC062687
Gene id: 6868
Gene description: ADAM metallopeptidase domain 17
Synonyms: ADAM18; CD156B; CSVP; NISBD; NISBD1; TACE; disintegrin and metalloproteinase domain-containing protein 17; ADAM metallopeptidase domain 18; TNF-alpha convertase; TNF-alpha converting enzyme; snake venom-like protease; tumor necrosis factor, alpha, converting enzyme; ADAM metallopeptidase domain 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggcagtctctcctattcctgaccagcgtggttcctttcgtgctggcgccgcgacctccggatgacccgggcttcggcccccaccagagactcgagaagcttgattctttgctctcagactacgatattctctctttatctaatatccagcagcattcggtaagaaaaagagatctacagacttcaacacatgtagaaacactactaactttttcagctttgaaaaggcattttaaattatacctgacatcaagtactgaacgtttttcacaaaatttcaaggtcgtggtggtggatggtaaaaacgaaagcgagtacactgtaaaatggcaggacttcttcactggacacgtggttggtgagcctgactctagggttctagcccacataagagatgatgatgttataatcagaatcaacacagatggggccgaatataacatagagccactttggagatttgttaatgataccaaagacaaaagaatgttagtttataaatctgaagatatcaagaatgtttcacgtttgcagtctccaaaagtgtgtggttatttaaaagtggataatgaagagttgctcccaaaagggttagtagacagagaaccacctgaaggtaagacttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ADAM metallopeptidase domain 33
- ADAM metallopeptidase domain 18
- TNF receptor-associated factor 6
- timeless homolog (Drosophila)

Buy ADAM17-ADAM metallopeptidase domain 17 Gene now

Add to cart