ANGPT1-angiopoietin 1 Gene View larger

ANGPT1-angiopoietin 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANGPT1-angiopoietin 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ANGPT1-angiopoietin 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029406
Product type: DNA & cDNA
Ncbi symbol: ANGPT1
Origin species: Human
Product name: ANGPT1-angiopoietin 1 Gene
Size: 2ug
Accessions: BC029406
Gene id: 284
Gene description: angiopoietin 1
Synonyms: AGP1; AGPT; ANG1; angiopoietin-1; ANG-1; angiopoietin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacacagtccacaaccttgtcaatctttgcactaaagaagttttactaaagggaggaaaaagagaggaagagaaaccatttagagactgtgcagatgtatatcaagctggttttaataaaagtggaatctacactatttatattaataatatgccagaacccaaaaaggtgttttgcaatatggatgtcaatgggggaggttggactgtaatacaacatcgtgaagatggaagtctagatttccaaagaggctggaaggaatataaaatgggttttggaaatccctccggtgaatattggctggggaatgagtttatttttgccattaccagtcagaggcagtacatgctaagaattgagttaatggactgggaagggaaccgagcctattcacagtatgacagattccacataggaaatgaaaagcaaaactataggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interleukin 17F
- laminin, beta 3
- interleukin 17A
- synaptogyrin 3

Buy ANGPT1-angiopoietin 1 Gene now

Add to cart