Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of UBXN4-UBX domain protein 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBXN4-UBX domain protein 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020806 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBXN4 |
| Origin species: | Human |
| Product name: | UBXN4-UBX domain protein 4 Gene |
| Size: | 2ug |
| Accessions: | BC020806 |
| Gene id: | 23190 |
| Gene description: | UBX domain protein 4 |
| Synonyms: | UBXD2; UBXDC1; erasin; UBX domain-containing protein 4; UBX domain containing 2; UBX domain-containing 1; UBX domain-containing protein 2; UBX domain protein 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgtggttccagggcgccattccggccgccatcgcgacggccaaaaggagcggcgcggtcttcgtggtgttcgtggcaggtgatgatgaacagtctacacagatggctgcaagttgggaagatgataaagttacagaagcatcttcaaacagttttgttgctattaaaatcgataccaaaagtgaagcctgcctacagttttcacaaatctgtatcctttcagtaaagaatggcttatatatatacatttatttaccttccttttggttaatttatgaaatttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - myeloid zinc finger 1 - defensin, beta 129 - lysyl oxidase-like 3 - tubby like protein 2 |