Login to display prices
Login to display prices
TPO-thyroid peroxidase Gene View larger

TPO-thyroid peroxidase Gene

PTXBC063107

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TPO-thyroid peroxidase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TPO-thyroid peroxidase Gene

Proteogenix catalog: PTXBC063107
Ncbi symbol: TPO
Product name: TPO-thyroid peroxidase Gene
Size: 2ug
Accessions: BC063107
Gene id: 7173
Gene description: thyroid peroxidase
Synonyms: MSA; TDH2A; TPX; thyroid microsomal antigen; thyroperoxidase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagagcgctggctgtgctgtctgtcacgctggttatggcctgcacagaagccttcttccccttcatctcgagagggaaagaactcctttggggaaagcctgaggagtctcgtgtctctagcgtcttggaggaaagcaagcgcctggtggacaccgccatgtacgccacgatgcagagaaacctcaagaaaagaggaatcctttctgcagctcagcttctgtctttttccaaacttcctgagccaacaagcggagtgattgcccgagcagcagagataatggaaacatcaatacaagcgatgaaaagaaaagtcaacctgaaaactcaacaatcacagcatccaacggatgctttatcagaagatctgctgagcatcattgcaaacatgtctggatgtctcccttacatgctgcccccaaaatgcccaaacacttgcctggcgaacaaatacaggcccatcacaggagcttgcaacaacagaaaaatgaaatataagcccgaccattccgaaactgccaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: