GTF2IRD2-GTF2I repeat domain containing 2 Gene View larger

GTF2IRD2-GTF2I repeat domain containing 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GTF2IRD2-GTF2I repeat domain containing 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GTF2IRD2-GTF2I repeat domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC067859
Product type: DNA & cDNA
Ncbi symbol: GTF2IRD2
Origin species: Human
Product name: GTF2IRD2-GTF2I repeat domain containing 2 Gene
Size: 2ug
Accessions: BC067859
Gene id: 84163
Gene description: GTF2I repeat domain containing 2
Synonyms: transcription factor GTF2IRD2-alpha; GTF2IRD2 alpha; FP630; GTF2IRD2A; general transcription factor II-I repeat domain-containing protein 2A; GTF2I repeat domain-containing protein 2, alpha; GTF2I repeat domain-containing protein 2A; general transcription factor II i repeat domain 2 alpha; GTF2I repeat domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccaggtagcagtgtccaccctgcctgttgaagaagagtcctcctcagagaccaggatggtggtgacattcctcgtgtctgccctcgaatccatgtgtaaagaactggccaagtccaaggcagaagtggcctgcatcgcagtgtacgaaacagacgtgtttgtcgtcggaaccgagagaggatgcgcttttgttaatgccaggacggattttcagaaagattttgcaaaatactgcgttgcagagggactgtgtgaggtgaaacctccctgccctgtgaacgggatgcaggtccactcgggcgaaacggaaatactcaggaaggcagtggaggactatttctgcttttgttatggtaaagccttagggacaacagtgatggtgcctgttccctatgagaagatgctgcgagaccagtcggctgtggtagtgcaggggcttccggaaggcgttgcctttcaacaccctgagaattacgaccttgcaaccctgaaatggattttggagaacaaagcagggatttcattcatcataaatagacccttcctaggaccagagagtcagctgggtggccctgggatggtaacagatgcggagagatccatagtatcaccaagtgaaagctgcggccccatcaatgtgaaaactgaacccatggaagattctggcatttcactgaaagcagaagctgtctcagtcaagaaagaatcagaagatcctaattactatcaatataatatgcaaggaagccacccttcttccacaagcaatgaagtaatagaaatggaattaccaatggaagattccactccgctggtcccttcagaagaaccaaatgaggaccctgaagccgaggtgaaaatcgaaggaaacacaaattcatccagtgttacaaattctgcagcaggtgttgaagatcttaacatcgttcaagtgactgttccagataatgagaaggaaagattatcaagcattgaaaagattaaacagctaagagaacaagttaatgacctctttagccgaaaatttggtgaagcaattggcgtggatttccctgtgaaagttccctacaggaagatcacattcaaccctggctgtgtggtgattgatggcatgcccccgggggtggtattcaaggcccccggctatctggaaatcagttccatgaggaggatcttggaggcagctgagtttatcaaattcacagtcatcaggccgcttccagggcttgagctcagtaatggacttttggaggccggggcaggaggattgcttgaggccgggagtttgaggccagcctgggcaacatggcaagaccccatctctacaaaaaatttaaaaattagctggaaacagtggctcacacctgtagccccagctacttggcaggctgaagcgggaggatcgcttgaactcaggagtttgagacagcagagaaccataattgcaatactgcactccagcctgggtgacagaacaagaccctgtctctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Rho GTPase activating protein 17
- Rho GTPase activating protein 26
- FSHD region gene 1 family, member B
- guanosine monophosphate reductase 2

Buy GTF2IRD2-GTF2I repeat domain containing 2 Gene now

Add to cart