Cart 7 Product Products 1 215,30 € (empty)
-
1 x KLHDC8B-ke...121,50 € -
-
1 x NDUFV2-NAD...113,40 € -
1 x CHST12-car...121,50 € -
-
-
No products
To be determined Shipping
1 215,30 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 215,30 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 215,30 €
Data sheet of UBE3B-ubiquitin protein ligase E3B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE3B-ubiquitin protein ligase E3B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC051266 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE3B |
| Origin species: | Human |
| Product name: | UBE3B-ubiquitin protein ligase E3B Gene |
| Size: | 2ug |
| Accessions: | BC051266 |
| Gene id: | 89910 |
| Gene description: | ubiquitin protein ligase E3B |
| Synonyms: | BPIDS; KOS; ubiquitin-protein ligase E3B; HECT-type ubiquitin transferase E3B; ubiquitin protein ligase E3B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcaccctgtctcagacctcgagagcatggttcatcgatagagcccgtcaggcacgagaagaaaggcttgtgcagaaggaacgggagcgggcagctgttgtgatccaggcccatgtccggagttttctctgtcggagtcgactgcagagagatatcaggagagagattgatgacttttttaaagcagatgaccctgagtccactaaaagaagtgcactttgtattttcaagattgccaggaaactgctgttcctattcagaatcaaagaggataatgagagatttgagaagttgtgtcgcagcatcctgagcagcatggatgctgagaatgagcctaaggtgtggtatgtgtccctggcttgttctaaggacctcaccctcctttggattcaacagatcaagaacattttgtggtactgctgtgattttctcaagcagctcaagcctgaaatcctgcaggactcccgactcatcaccctgtacctcacgatgcttgtcaccttcacagacacttcaacgtggaaaattcttcggggaaaaggtgaaagtcttcgaccagcgatgaaccacatttgtgcaaatataatgggacatctcaaccagcatggattttattctgtgctgcagtgctgtgatgggctgtttcctgatttggtttcatatgctcctcacaacaaccctgtgaggtggtccgttggcagaagctggtatgactggcagttgtctcgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc fingers and homeoboxes 3 - myelin transcription factor 1 - dihydrolipoamide dehydrogenase - glia maturation factor, gamma |