UBE3B-ubiquitin protein ligase E3B Gene View larger

UBE3B-ubiquitin protein ligase E3B Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE3B-ubiquitin protein ligase E3B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UBE3B-ubiquitin protein ligase E3B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC051266
Product type: DNA & cDNA
Ncbi symbol: UBE3B
Origin species: Human
Product name: UBE3B-ubiquitin protein ligase E3B Gene
Size: 2ug
Accessions: BC051266
Gene id: 89910
Gene description: ubiquitin protein ligase E3B
Synonyms: BPIDS; KOS; ubiquitin-protein ligase E3B; HECT-type ubiquitin transferase E3B; ubiquitin protein ligase E3B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcaccctgtctcagacctcgagagcatggttcatcgatagagcccgtcaggcacgagaagaaaggcttgtgcagaaggaacgggagcgggcagctgttgtgatccaggcccatgtccggagttttctctgtcggagtcgactgcagagagatatcaggagagagattgatgacttttttaaagcagatgaccctgagtccactaaaagaagtgcactttgtattttcaagattgccaggaaactgctgttcctattcagaatcaaagaggataatgagagatttgagaagttgtgtcgcagcatcctgagcagcatggatgctgagaatgagcctaaggtgtggtatgtgtccctggcttgttctaaggacctcaccctcctttggattcaacagatcaagaacattttgtggtactgctgtgattttctcaagcagctcaagcctgaaatcctgcaggactcccgactcatcaccctgtacctcacgatgcttgtcaccttcacagacacttcaacgtggaaaattcttcggggaaaaggtgaaagtcttcgaccagcgatgaaccacatttgtgcaaatataatgggacatctcaaccagcatggattttattctgtgctgcagtgctgtgatgggctgtttcctgatttggtttcatatgctcctcacaacaaccctgtgaggtggtccgttggcagaagctggtatgactggcagttgtctcgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc fingers and homeoboxes 3
- myelin transcription factor 1
- dihydrolipoamide dehydrogenase
- glia maturation factor, gamma

Buy UBE3B-ubiquitin protein ligase E3B Gene now

Add to cart