Login to display prices
Login to display prices
HP1BP3-heterochromatin protein 1, binding protein 3 Gene View larger

HP1BP3-heterochromatin protein 1, binding protein 3 Gene

PTXBC032139

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HP1BP3-heterochromatin protein 1, binding protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HP1BP3-heterochromatin protein 1, binding protein 3 Gene

Proteogenix catalog: PTXBC032139
Ncbi symbol: HP1BP3
Product name: HP1BP3-heterochromatin protein 1, binding protein 3 Gene
Size: 2ug
Accessions: BC032139
Gene id: 50809
Gene description: heterochromatin protein 1, binding protein 3
Synonyms: HP1-BP74; HP1BP74; heterochromatin protein 1-binding protein 3; heterochromatin protein 1 binding protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgactgatacgtctcaaggtgaactcgtccatcctaaggcactcccacttatagtaggagctcagctgatccacgcggacaagttaggtgagaaggtagaagatagcaccatgccgattcgtcgaactgtgaattctacccgggaaactcctcccaaaagcaagcttgctgaaggggaggaagaaaagccagaaccagacataagttcagaggaatctgtctccactgtagaagaacaagagaatgaaactccacctgctacttcgagtgaggcagagcagccaaagggggaacctgagaatgaagagaaggaagaaaataagtcttctgaggaaaccaaaaaggagagagctgatagtattcattccactcttttcataattggtcagaacagttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: