HP1BP3-heterochromatin protein 1, binding protein 3 Gene View larger

HP1BP3-heterochromatin protein 1, binding protein 3 Gene

PTXBC032139

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HP1BP3-heterochromatin protein 1, binding protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HP1BP3-heterochromatin protein 1, binding protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032139
Product type: DNA & cDNA
Ncbi symbol: HP1BP3
Origin species: Human
Product name: HP1BP3-heterochromatin protein 1, binding protein 3 Gene
Size: 2ug
Accessions: BC032139
Gene id: 50809
Gene description: heterochromatin protein 1, binding protein 3
Synonyms: HP1-BP74; HP1BP74; heterochromatin protein 1-binding protein 3; heterochromatin protein 1 binding protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgactgatacgtctcaaggtgaactcgtccatcctaaggcactcccacttatagtaggagctcagctgatccacgcggacaagttaggtgagaaggtagaagatagcaccatgccgattcgtcgaactgtgaattctacccgggaaactcctcccaaaagcaagcttgctgaaggggaggaagaaaagccagaaccagacataagttcagaggaatctgtctccactgtagaagaacaagagaatgaaactccacctgctacttcgagtgaggcagagcagccaaagggggaacctgagaatgaagagaaggaagaaaataagtcttctgaggaaaccaaaaaggagagagctgatagtattcattccactcttttcataattggtcagaacagttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 69, member A
- FK506 binding protein 6, 36kDa pseudogene
- minichromosome maintenance complex component 8
- bone morphogenetic protein receptor, type IA

Buy HP1BP3-heterochromatin protein 1, binding protein 3 Gene now

Add to cart