Cart 33 Product Products 6 093,73 € (empty)
-
1 x FAM102A-fa...113,40 € -
-
-
1 x C7orf49-ch...113,40 € -
1 x KIAA1191-K...121,50 € -
1 x SFXN4-side...121,50 € -
1 x SMYD1-SET...121,50 € -
1 x KIF26A-kin...113,40 € -
1 x RPL35-ribo...113,40 € -
1 x HLA-F-majo...121,50 € -
1 x HMGN3-high...113,40 € -
1 x HMGA1-high...113,40 € -
1 x NOSTRIN-ni...121,50 € -
1 x ZNF614-zin...113,40 € -
1 x NTSR2-neur...121,50 € -
1 x ABHD7-abhy...121,50 € -
-
1 x ANKRD22-an...113,40 € -
1 x CCDC51-coi...121,50 € -
1 x TSC22D4-TS...121,50 € -
1 x MKRN3-mako...113,40 € -
1 x MS4A3-memb...113,40 € -
1 x ASPA-aspar...121,50 € -
1 x COL20A1-co...113,40 € -
1 x APP-amyloi...121,50 € -
1 x NSUN5-NOL1...121,50 € -
1 x NMU-neurom...113,40 € -
1 x SLC38A1-so...121,50 € -
-
-
-
-
No products
To be determined Shipping
6 093,73 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 33 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 6 093,73 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 6 093,73 €
Data sheet of XAGE3-X antigen family, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about XAGE3-X antigen family, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062680 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | XAGE3 |
| Origin species: | Human |
| Product name: | XAGE3-X antigen family, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC062680 |
| Gene id: | 170626 |
| Gene description: | X antigen family, member 3 |
| Synonyms: | CT12.3a; CT12.3b; GAGED4; PLAC6; XAGE-3; pp9012; X antigen family member 3; CT12.3; G antigen, family D, 4; cancer/testis antigen 12.3; cancer/testis antigen family 12, member 3a; cancer/testis antigen family 12, member 3b; g antigen family D member 4; placenta-specific 6; placenta-specific gene 6 protein; protein XAGE-3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatttggcgaggaagatcaacatataggcctaggccgaggagaagtgtaccacctcctgagctgattgggcctatgctggagcccggtgatgaggagcctcagcaagaggaaccaccaactgaaagtcgggatcctgcacctggtcaggagagagaagaagatcagggtgcagctgagactcaagtgcctgacctggaagctgatctccaggagctgtctcagtcaaagactgggggtgaatgtggaaatggtcctgatgaccaggggaagattctgccaaaatcagaacaatttaaaatgccagaaggaggtgacaggcaaccacaggtttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serine carboxypeptidase 1 - gamma-glutamyltransferase 5 - ankyrin repeat domain 12 - gamma-glutamyltransferase 6 |