XAGE3-X antigen family, member 3 Gene View larger

XAGE3-X antigen family, member 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of XAGE3-X antigen family, member 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about XAGE3-X antigen family, member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC062680
Product type: DNA & cDNA
Ncbi symbol: XAGE3
Origin species: Human
Product name: XAGE3-X antigen family, member 3 Gene
Size: 2ug
Accessions: BC062680
Gene id: 170626
Gene description: X antigen family, member 3
Synonyms: CT12.3a; CT12.3b; GAGED4; PLAC6; XAGE-3; pp9012; X antigen family member 3; CT12.3; G antigen, family D, 4; cancer/testis antigen 12.3; cancer/testis antigen family 12, member 3a; cancer/testis antigen family 12, member 3b; g antigen family D member 4; placenta-specific 6; placenta-specific gene 6 protein; protein XAGE-3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatttggcgaggaagatcaacatataggcctaggccgaggagaagtgtaccacctcctgagctgattgggcctatgctggagcccggtgatgaggagcctcagcaagaggaaccaccaactgaaagtcgggatcctgcacctggtcaggagagagaagaagatcagggtgcagctgagactcaagtgcctgacctggaagctgatctccaggagctgtctcagtcaaagactgggggtgaatgtggaaatggtcctgatgaccaggggaagattctgccaaaatcagaacaatttaaaatgccagaaggaggtgacaggcaaccacaggtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine carboxypeptidase 1
- gamma-glutamyltransferase 5
- ankyrin repeat domain 12
- gamma-glutamyltransferase 6

Buy XAGE3-X antigen family, member 3 Gene now

Add to cart