GPR61-G protein-coupled receptor 61 Gene View larger

GPR61-G protein-coupled receptor 61 Gene

PTXBC067464

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPR61-G protein-coupled receptor 61 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPR61-G protein-coupled receptor 61 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC067464
Product type: DNA & cDNA
Ncbi symbol: GPR61
Origin species: Human
Product name: GPR61-G protein-coupled receptor 61 Gene
Size: 2ug
Accessions: BC067464
Gene id: 83873
Gene description: G protein-coupled receptor 61
Synonyms: BALGR; GPCR3; biogenic amine receptor-like G-protein coupled receptor; biogenic amine receptor-like GPCR; G protein-coupled receptor 61
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtcctcacccatcccccagtcatcagggaactcttccactttggggagggtccctcaaaccccaggtccctctactgccagtggggtcccggaggtggggctacgggatgttgcttcggaatctgtggccctcttcttcatgctcctgctggacttgactgctgtggctggcaatgccgctgtgatggccgtgatcgccaagacgcctgccctccgaaaatttgtcttcgtcttccacctctgcctggtggacctgctggctgccctgaccctcatgcccctggccatgctctccagctctgccctctttgaccacgccctctttggggaggtggcctgccgcctctacttgtttctgagcgtgtgctttgtcagcctggccatcctctcggtgtcagccatcaatgtggagcgctactattacgtagtccaccccatgcgctacgaggtgcgcatgacgctggggctggtggcctctgtgctggtgggtgtgtgggtgaaggccttggccatggcttctgtgccagtgttgggaagggtctcctgggaggaaggagctcccagtgtccccccaggctgttcactccagtggagccacagtgcctactgccagctttttgtggtggtctttgctgtcctttactttctgttgcccctgctcctcatacttgtggtctactgcagcatgttccgagtggcccgcgtggctgccatgcagcacgggccgctgcccacgtggatggagacaccccggcaacgctccgaatctctcagcagccgctccacgatggtcaccagctcgggggccccccagaccaccccacaccggacgtttgggggagggaaagcagcagtggttctcctggctgtggggggacagttcctgctctgttggttgccctacttctctttccacctctatgttgccctgagtgctcagcccatttcaactgggcaggtggagagtgtggtcacctggattggctacttttgcttcacttccaaccctttcttctatggatgtctcaaccggcagatccggggggagctcagcaagcagtttgtctgcttcttcaagccagctccagagaaggagctgaggctgcctagccgggagggctccattgaggagaacttcctgcagttccttcaggggactggctgtccttctgagtcctgggtttcccgacccctacccagccccaagcaggagccacctgctgttgactttcgaatcccaggccagatagctgaggagacctctgagttcctggagcagcaactcaccagcgacatcatcatgtcagacagctacctccgtcctgccgcctcaccccggctggagtcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G protein-coupled receptor 75
- APOBEC1 complementation factor
- activin A receptor, type IIA
- complement factor H-related 3

Buy GPR61-G protein-coupled receptor 61 Gene now

Add to cart