Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ALKBH2-alkB, alkylation repair homolog 2 (E. coli) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ALKBH2-alkB, alkylation repair homolog 2 (E. coli) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC070489 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ALKBH2 |
| Origin species: | Human |
| Product name: | ALKBH2-alkB, alkylation repair homolog 2 (E. coli) Gene |
| Size: | 2ug |
| Accessions: | BC070489 |
| Gene id: | 121642 |
| Gene description: | alkB, alkylation repair homolog 2 (E. coli) |
| Synonyms: | DNA oxidative demethylase ALKBH2; ABH2; 2OG-Fe(II) oxy DC1; alkB, alkylation repair homolog 2; alkylated DNA repair protein alkB homolog 2; alpha-ketoglutarate-dependent dioxygenase alkB homolog 2; oxy DC1; alkB homolog 2, alpha-ketoglutarate dependent dioxygenase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacagattcctggtgaaaggggctcaagggggccttttgaggaagcaggaggagcaagagccaactggagaagagccagctgtgttgggaggagacaaagaaagcacaaggaagaggcccaggagagaggccccagggaatggaggccactcagcaggccctagctggcggcacattcgggctgagggcctggactgcagttacacagtcctgtttggcaaagctgaggcagatgagattttccaagagttggagaaagaagtagaatattttacaggagcactggccagagtccaggtattcgggaagtggcacagtgtgcccaggaagcaggcaacgtatggcgacgctgggctgacctacacattttcaggcctcacgctgtctccaaagccctggatcccagttctagagcgcatccgggatcacgtctctggggtgactggacagaccttcaactttgtgctcatcaacaggtataaagatggctgtgaccacatcggggagcaccgagatgatgaaagagaactggcccctgggagccccattgcctctgtctccttcggtgcctgcagagactttgtcttccggcataaggattcccgtgggaaaagcccctccaggagggtggcggtggtcaggctgccgctggcccacgggagcttactaatgatgaaccacccgaccaacacgcactggtaccacagtcttcccgtgagaaagaaggttctggctccacgggtgaatctgacttttcgtaaaattttgcttactaaaaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 4, regulatory subunit 4 - MAP/microtubule affinity-regulating kinase 4 - receptor (chemosensory) transporter protein 2 - chaperonin containing TCP1, subunit 8 (theta) |