Cart 10 Product Products 1 466,51 € (empty)
-
1 x DENR-densi...113,40 € -
1 x CLEC1A-C-t...121,50 € -
1 x NPEPL1-ami...121,50 € -
-
-
-
1 x Goat...223,00 € -
1 x Goat...287,00 € -
-
1 x Goat...275,00 €
No products
To be determined Shipping
1 466,51 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 466,51 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 466,51 €
Data sheet of GPR52-G protein-coupled receptor 52 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR52-G protein-coupled receptor 52 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC067456 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR52 |
| Origin species: | Human |
| Product name: | GPR52-G protein-coupled receptor 52 Gene |
| Size: | 2ug |
| Accessions: | BC067456 |
| Gene id: | 9293 |
| Gene description: | G protein-coupled receptor 52 |
| Synonyms: | G protein-coupled receptor 52 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatgaatccaggtggactgaatggaggatcctgaacatgagcagtggcattgtgaatgtgtccgagcgtcactcctgcccacttggatttggccactacagtgtggtggatgtctgcatcttcgagacagtggttattgtgttgctgacatttctgatcattgctgggaatctaacagttatctttgtctttcattgtgctccactgttacatcattatactaccagctatttcattcagacgatggcatatgctgatcttttcgttggagttagctgcttggttcctactctgtcacttctccactactccacaggtgtccacgagtcattgacttgccaggtttttggatatatcatctcagttctaaaaagtgtttctatggcgtgtcttgcttgcatcagtgtggatcgttatcttgcaataaccaagcctctttcctacaatcaactggtcaccccttgtcgcttgagaatttgcattattttgatctggatctactcctgcctaattttcttgccttccttttttggctgggggaaacctggttaccatggtgacatttttgaatggtgtgccacgtcttggctcaccagtgcctattttactggctttattgtttgtttactttatgctcctgctgcctttgttgtctgcttcacttacttccacattttcaaaatttgccgtcagcacaccaaagagataaatgaccgaagagcccgattccctagtcatgaggtagattcttccagagagactggacacagccctgaccgtcgctacgccatggttttgtttaggataaccagtgtattttatatgctgtggctcccctatataatttactttcttctagaaagctcccgggtcttggacaatccaactctgtccttcttaacaacctggcttgcaataagtaatagtttttgtaactgtgtaatatacagcctctccaacagcgttttccggctaggcctccgaagactgtctgagacaatgtgcacatcctgtatgtgtgtgaaggatcaggaagcacaagaacccaaacctaggaaacgggctaattcttgctccatttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - G protein-coupled receptor 21 - G protein-coupled receptor 52 - poliovirus receptor-related 3 - G protein-coupled receptor 83 |