Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TDGF1-teratocarcinoma-derived growth factor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TDGF1-teratocarcinoma-derived growth factor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC067844 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TDGF1 |
| Origin species: | Human |
| Product name: | TDGF1-teratocarcinoma-derived growth factor 1 Gene |
| Size: | 2ug |
| Accessions: | BC067844 |
| Gene id: | 6997 |
| Gene description: | teratocarcinoma-derived growth factor 1 |
| Synonyms: | CRGF; CRIPTO; teratocarcinoma-derived growth factor 1; cripto-1 growth factor; epidermal growth factor-like cripto protein CR1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggactgcaggaagatggcccgcttctcttacagtgtgatttggatcatggccatttctaaagcctttgaactgggattagttgccgggctgggccatcaggaatttgctcgtccatctcggggatacctggccttcagagatgacagcatttggccccaggaggagcctgcaattcggcctcggtcttcccagcgtgtgccgcccatggggatacagcacagtaaggagctaaacagaacctgctgcctgaatgggggaacctgcatgctggggtccttttgtgcctgccctccctccttctacggacggaactgtgagcacgatgtgcgcaaagagaactgtgggtctgtgccccatgacacctggctgcccaagaagtgttccctgtgtaaatgctggcacggtcagctccgctgctttcctcaggcatttctacccggctgtgatggccttgtgatggatgagcacctcgtggcttccaggactccagaactaccaccgtctgcacgtactaccacttttatgctagttggcatctgcctttctatacaaagctactattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - poly(A) binding protein, cytoplasmic 5 - ankyrin repeat and SOCS box-containing 5 - growth factor receptor-bound protein 14 - mannosidase, alpha, class 2C, member 1 |