Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MRGPRX3-MAS-related GPR, member X3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRGPRX3-MAS-related GPR, member X3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC067292 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRGPRX3 |
| Origin species: | Human |
| Product name: | MRGPRX3-MAS-related GPR, member X3 Gene |
| Size: | 2ug |
| Accessions: | BC067292 |
| Gene id: | 117195 |
| Gene description: | MAS-related GPR, member X3 |
| Synonyms: | GPCR; MRGX3; SNSR1; SNSR2; mas-related G-protein coupled receptor member X3; G protein-coupled receptor MRGX3; G protein-coupled receptor SNSR1; G protein-coupled receptor SNSR2; MAS-related GPR, member X3; mas-related GPCR member X3; sensory neuron-specific G-protein coupled receptor 1/2; MAS related GPR family member X3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggattcaaccatcccagtcttgggtacagaactgacaccaatcaacggacgtgaggagactccttgctacaagcagaccctgagcttcacggggctgacgtgcatcgtttcccttgtcgcgctgacaggaaacgcggttgtgctctggctcctgggctgccgcatgcgcaggaacgctgtctccatctacatcctcaacctggtcgcggccgacttcctcttccttagcggccacattatacgttcgccgttacgcctcatcaatatccgccatcccatctccaaaatcctcagtcctgtgatgacctttccctactttataggcctaagcatgctgagcgccatcagcaccgagcgctgcctgtccatcctgtggcccatctggtaccactgccgccgccccagatacctgtcatcggtcatgtgtgtcctgctctgggccctgtccctgctgcggagtatcctggagtggatgttctgtgacttcctgtttagtggtgctgattctgtttggtgtgaaacgtcagatttcattacaatcgcgtggctggtttttttatgtgtggttctctgtgggtccagcctggtcctgctggtcaggattctctgtggatcccggaagatgccgctgaccaggctgtacgtgaccatcctcctcacagtgctggtcttcctcctctgtggcctgccctttggcattcagtgggccctgttttccaggatccacctggattggaaagtcttattttgtcatgtgcatctagtttccattttcctgtccgctcttaacagcagtgccaaccccatcatttacttcttcgtgggctcctttaggcagcgtcaaaataggcagaacctgaagctggttctccagagggctctgcaggacacgcctgaggtggatgaaggtggagggcagcttcctcaggaaaccctggagctgtcgggaagcagattggagcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - retinoic acid receptor, alpha - fatty acid amide hydrolase 2 - RNA binding motif protein 45 - period homolog 1 (Drosophila) |