Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ABCA9-ATP-binding cassette, sub-family A (ABC1), member 9 Gene
PTXBC062472
New product
Data sheet of ABCA9-ATP-binding cassette, sub-family A (ABC1), member 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ABCA9-ATP-binding cassette, sub-family A (ABC1), member 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062472 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ABCA9 |
| Origin species: | Human |
| Product name: | ABCA9-ATP-binding cassette, sub-family A (ABC1), member 9 Gene |
| Size: | 2ug |
| Accessions: | BC062472 |
| Gene id: | 10350 |
| Gene description: | ATP-binding cassette, sub-family A (ABC1), member 9 |
| Synonyms: | EST640918; ATP-binding cassette sub-family A member 9; ATP-binding cassette A9; ATP-binding cassette, sub-family A (ABC1), member 9; ATP binding cassette subfamily A member 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggtggcctgatgaaaaaagcatggatgaattggatttgaactattcaatagacgcagtgagagtcatctttactgataccttctcctaccatttgaagttttcttggggacatagaatccccatgatgaaagagcacagagaccattcagctcactgtcaagcagtgaatgaaaaaatgaagtgtgaaggttcagagttctgggagaaaggctttgtagcttttcaagctgccattaatgctgctatcatagaaatcgcaacaaatcattcagtgatggaacagctgatgtcagttactggtgtacatatgaagatattaccttttgttgcccaaggaggagttgcaactgattttttcattttcttttgcattatttctttttctacatttatatactatgtatcagtcaatgttacacaagaaagacaatacattacgtcattgatgacaatgatgggactccgagagtcagcattctggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dishevelled associated activator of morphogenesis 2 - actin related protein 2/3 complex, subunit 3, 21kDa - vacuolar protein sorting 39 homolog (S. cerevisiae) - vacuolar protein sorting 16 homolog (S. cerevisiae) |