Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIST1H2AC-histone cluster 1, H2ac Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIST1H2AC-histone cluster 1, H2ac Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC050602 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIST1H2AC |
| Origin species: | Human |
| Product name: | HIST1H2AC-histone cluster 1, H2ac Gene |
| Size: | 2ug |
| Accessions: | BC050602 |
| Gene id: | 8334 |
| Gene description: | histone cluster 1, H2ac |
| Synonyms: | H2A/l; H2AFL; dJ221C16.4; histone H2A type 1-C; H2A histone family, member L; histone 1, H2ac; histone H2A/l; histone H2AC; histone cluster 1, H2ac; histone cluster 1 H2A family member c |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctggacgtggtaagcaaggaggcaaagctcgcgccaaagcgaaatcccgctcttctcgcgctggtctccagttcccggtgggccgagtgcaccgcctgctccgtaaaggcaactacgcagagcgggttggggcaggcgcgccggtgtacctggcggcggtgttagagtacctgaccgccgagatcctggagctggccggcaacgcggctcgcgacaacaagaagactcgcatcatcccgcgccacttgcagctggccatccgcaacgacgaggagctcaacaaactgctaggccgggtgaccattgctcagggcggcgtccttcctaacatccaggccgtgcttctgcctaagaagaccgagagtcaccacaaggccaagggcaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - spindlin family, member 2A - kelch-like 10 (Drosophila) - SEC23 interacting protein - kelch-like 32 (Drosophila) |