Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C22orf13-chromosome 22 open reading frame 13 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C22orf13-chromosome 22 open reading frame 13 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC070109 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C22orf13 |
| Origin species: | Human |
| Product name: | C22orf13-chromosome 22 open reading frame 13 Gene |
| Size: | 2ug |
| Accessions: | BC070109 |
| Gene id: | 83606 |
| Gene description: | chromosome 22 open reading frame 13 |
| Synonyms: | C22orf13; LLN4; protein GUCD1; CG13760 gene product [Drosophila melanogaster] homolog; guanylyl cyclase domain-containing protein 1; guanylyl cyclase domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggacggaggcggaggcagcggggccgccgctcgagcccggggactttgtgcaactgcctgtgcccgtcatccagcagctctaccactgggactgtggcctggcctgctccaggatggtgctgcggtacctgggccagctggacgacagtgagtttgagagagccctgcagaagctgcagctgaccaggagcatctggaccatcgacctggcctacctgatgcaccactttggcgtgaggcaccgcttctgtacccagaccctgggtgtcgacaagggctacaagaaccagtccttctacaggaagcactttgacacagaagagacccgggtgaatcagctgtttgcacaagcaaaggcctgcaaggtgctggtggagaaatgcacagtgagtgtgaaggacatccaggcgcacctggctcagggccatgtggccatcgtgctggtgaactcgggggtgctgcactgtgacctgtgctccagccctgtcaagtactgctgcttcacccccagtggccaccactgcttctgccgcactcctgactaccagggccacttcatcgtgctgcgtggctacaaccgggccactggctgcatcttctacaacaacccagcctatgccgaccgaatgtgcagcaccagcatcagtaactttgaggaggccagaaccagctatggcacagatgaggacatcctctttgtctacttggacagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 17 open reading frame 97 - chromosome 1 open reading frame 201 - chromosome 1 open reading frame 174 - adrenergic, beta-2-, receptor, surface |