Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TNFAIP3-tumor necrosis factor, alpha-induced protein 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFAIP3-tumor necrosis factor, alpha-induced protein 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC064689 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFAIP3 |
| Origin species: | Human |
| Product name: | TNFAIP3-tumor necrosis factor, alpha-induced protein 3 Gene |
| Size: | 2ug |
| Accessions: | BC064689 |
| Gene id: | 7128 |
| Gene description: | tumor necrosis factor, alpha-induced protein 3 |
| Synonyms: | AISBL; OTUD7C; TNFA1P2; tumor necrosis factor alpha-induced protein 3; OTU domain-containing protein 7C; tumor necrosis factor inducible protein A20; tumor necrosis factor, alpha induced protein 3; zinc finger protein A20; TNF alpha induced protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgaacaagtccttcctcaggctttgtatttgagcaatatgcggaaagctgtgaagatacgggagagaactccagaagacatttttaaacctactaatgggatcattcatcattttaaaaccatgcaccgatacacactggaaatgttcagaacttgccagttttgtcctcagtttcgggagatcatccacaaagccctcatcgacagaaacatccaggccaccctggaaagccagaagaaactcaactggtgtcgagaagtccggaagcttgtggcgctgaaaacgaacggtgacggcaattgcctcatgcatgccacttctcagtacatgtggggcgttcaggacacagacttggtactgaggaaggcgctgttcagcacgctcaaggaaacagacacacgcaactttaaattccgctggcaactggagtctctcaaatctcaggaatttgttgaaacggggctttgctatgatactcggaactggaatgatgaatgggacaatcttatcaaaatggcttccacagacacacccatggcccgaagtggacttcagtacaactcactggaagaaatacacatatttgtcctttgcaacatcctcagaaggccaatcattgtcatttcaggtgagatgcctgcagatcacggatctgtacttaaatgctttcagccttatgccttggctcctggagaaaaccacactgccaaagttcaggtaacagagttcaatggaatttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - acyl-CoA synthetase medium-chain family member 5 - cyclin D binding myb-like transcription factor 1 - UDP-glucose ceramide glucosyltransferase-like 2 - guanylate binding protein 2, interferon-inducible |