Cart 5 Product Products 736,80 € (empty)
-
1 x NSL1-NSL1,...121,50 € -
1 x NTRK2-neur...121,50 € -
1 x Donkey...267,00 € -
1 x NSUN5C-NOL...113,40 € -
1 x TRIML1-tri...113,40 €
No products
To be determined Shipping
736,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 736,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 736,80 €
Data sheet of CPNE8-copine VIII Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CPNE8-copine VIII Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC046366 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CPNE8 |
| Origin species: | Human |
| Product name: | CPNE8-copine VIII Gene |
| Size: | 2ug |
| Accessions: | BC046366 |
| Gene id: | 144402 |
| Gene description: | copine VIII |
| Synonyms: | copine-8; copine VIII; copine 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatccttaccaactgaatgcctatggtatggcactaaaagcagtgggagaaattgttcaagattatgacagtgataaaatgtttccagctctaggatttggtgcaaaactgcctccagatggaaggatatctcacgaatttgctttgaatgggaatcctcaaaacccctactgtgatggcattgagggggtcatggaggcttattacaggagtctgaaatctgtacaactatatgggcccaccaactttgctcctgtaattaatcatgtagcaagatatgcttcttctgtaaaggatggctcccagtattttgtgcttctgattgttacagatggtgttatctcagatatggcccagactaaggagtccatagttaatgcctcaaaacttccaatgtcaataattatagtaggtgttggaccagcagaatttgatgcaatggtcgaattggatggagatgatgtaagagtctcctctagaggaaaatatgctgaaagagacattgtgcagtttgtgccattcagggattatattgacagaagtggaaaccacatactgagcatggctagattggctaaagatgtcctagctgagatccctgagcagtttctctcctatatgagagcccgaggaatcaagccatcacctgcgcctcccccatacaccccacctacacatgtgttacagactcaaatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gasdermin C - neuregulin 1 - paired box 3 - KIAA0892 |