Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LY6G6C-lymphocyte antigen 6 complex, locus G6C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LY6G6C-lymphocyte antigen 6 complex, locus G6C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036302 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LY6G6C |
| Origin species: | Human |
| Product name: | LY6G6C-lymphocyte antigen 6 complex, locus G6C Gene |
| Size: | 2ug |
| Accessions: | BC036302 |
| Gene id: | 80740 |
| Gene description: | lymphocyte antigen 6 complex, locus G6C |
| Synonyms: | C6orf24; G6c; NG24; lymphocyte antigen 6 complex locus protein G6c; lymphocyte antigen-6 G6C; lymphocyte antigen 6 complex, locus G6C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaagcccttatgctgctcaccctgtctgttctgctctgctgggtctcagctgacattcgctgtcactcctgctacaaggtccctgtgctgggctgtgtggaccggcagtcctgccgcctggagccaggacagcaatgcctgacaacacatgcataccttggtaagatgtgggttttctccaatctgcgctgtggcacaccagaagagccctgtcaggaggccttcaaccaaaccaaccgtaagctgggtctgacatataacaccacctgctgcaacaaggacaactgcaacagcgcaggaccccggcccactccagccctgggccttgtcttccttacctccttggctggccttggcctctggctgctgcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil and C2 domain containing 2B - cytokine induced apoptosis inhibitor 1 - suppressor of Ty 7 (S. cerevisiae)-like - DiGeorge syndrome critical region gene 8 |