Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FAM12A-family with sequence similarity 12, member A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM12A-family with sequence similarity 12, member A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069407 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM12A |
| Origin species: | Human |
| Product name: | FAM12A-family with sequence similarity 12, member A Gene |
| Size: | 2ug |
| Accessions: | BC069407 |
| Gene id: | 10876 |
| Gene description: | family with sequence similarity 12, member A |
| Synonyms: | FAM12A; EP3A; HE3-ALPHA; HE3A; HE3ALPHA; RAM1; epididymal secretory protein E3-alpha; epididymis-specific 3 alpha; family with sequence similarity 12, member A; human epididymis-specific 3 alpha; human epididymis-specific protein 3-alpha; ribonuclease A M1; epididymal protein 3A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacatcctctctaaagatttggggcatactcttggccctgctttgcatcctttgcaggctgtgtgtatacagtaacaacatttactggagagaattcataaaacttcattacttaagtccaagtcgagaattcaaagagtacaaatgtgatgtcctcatgagagaaaaagaggctctgaaaggcaagagctttcatatgttcatctatagcttatggttcaaaattcagcgtgcatgcatcaatgagaaggggagtgaccgatatagaaatgcatatgtatgggccccaggtgccctcaaagtactcgagtgtcactgggagaagtacaacaataggtacacagagagcagaagcttcagctacattgaattccattgtggcgtagatggatatgttgataacatagaagacctgaggattatagaacctatcagcaactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 45, member B - tubulin tyrosine ligase-like family, member 7 - tubulin tyrosine ligase-like family, member 2 - family with sequence similarity 53, member A |