Cart 33 Product Products 4 412,94 € (empty)
-
1 x HIST1H2AJ-...113,40 € -
1 x CYTH2-cyto...121,50 € -
1 x ITGB3BP-in...113,40 € -
1 x ADH4-alcoh...121,50 € -
1 x GLIPR1-GLI...121,50 € -
1 x NUSAP1-nuc...121,50 € -
-
1 x SLC2A3-sol...121,50 € -
1 x PBX2-pre-B...121,50 € -
1 x FMO2-flavi...121,50 € -
1 x TMEM9B-TME...113,40 € -
-
1 x SPIN2B-spi...113,40 € -
1 x ZNRD1-zinc...113,40 € -
1 x PCGF2-poly...121,50 € -
1 x CRB3-crumb...113,40 € -
-
1 x GGCT-gamma...113,40 € -
1 x NUDCD3-Nud...121,50 € -
1 x SPG7-spast...121,50 € -
-
-
1 x NUP43-nucl...121,50 € -
1 x ZNF688-zin...121,50 € -
-
1 x WWP2-WW...121,50 € -
-
1 x ZNF738-zin...113,40 € -
-
1 x TMEM68-tra...113,40 € -
1 x GSTZ1-glut...113,40 € -
1 x ZNF695-zin...113,40 € -
No products
To be determined Shipping
4 412,94 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 33 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 412,94 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 412,94 €
Data sheet of DLX6-distal-less homeobox 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DLX6-distal-less homeobox 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069363 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DLX6 |
| Origin species: | Human |
| Product name: | DLX6-distal-less homeobox 6 Gene |
| Size: | 2ug |
| Accessions: | BC069363 |
| Gene id: | 1750 |
| Gene description: | distal-less homeobox 6 |
| Synonyms: | homeobox protein DLX-6; distal-less homeo box 6; distal-less homeobox 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagccactcgcagcacagcccttacctccagtcctaccacaacagcagcgcagccgcccagacgcgaggggacgacacagatcaacaaaaaactacagtgattgaaaacggggaaatcaggttcaatggaaaagggaaaaagattcggaagcctcggaccatttattccagcctgcagctccaggctttaaaccatcgctttcagcagacacagtatctggcccttccagagagagccgaactggcagcttccttaggactgacacaaacacaggtgaagatatggtttcagaacaaacgctctaagtttaagaaactgctgaagcagggcagtaatcctcatgagagcgaccccctccagggctcggcggccctgtcgccacgctcgccagcgctgcctccagtctgggacgtttctgcctcggccaagggtgtcagtatgccccccaacagctacatgcctggctattctcactggtactcctctccacaccaggacacgatgcagagaccacagatgatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proline rich 5 (renal) - ribosomal protein L15 - ribosomal protein S16 - myo-inositol oxygenase |