Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IL22-interleukin 22 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL22-interleukin 22 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069308 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL22 |
| Origin species: | Human |
| Product name: | IL22-interleukin 22 Gene |
| Size: | 2ug |
| Accessions: | BC069308 |
| Gene id: | 50616 |
| Gene description: | interleukin 22 |
| Synonyms: | IL-21; IL-22; IL-D110; IL-TIF; ILTIF; TIFIL-23; TIFa; zcyto18; interleukin-22; IL-10-related T-cell-derived inducible factor; cytokine Zcyto18; interleukin 22 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgccctgcagaaatctgtgagctctttccttatggggaccctggccaccagctgcctccttctcttggccctcttggtacagggaggagcagctgcgcccatcagctcccactgcaggcttgacaagtccaacttccagcagccctatatcaccaaccgcaccttcatgctggctaaggaggctagcttggctgataacaacacagacgttcgtctcattggggagaaactgttccacggagtcagtatgagtgagcgctgctatctgatgaagcaggtgctgaacttcacccttgaagaagtgctgttccctcaatctgataggttccagccttatatgcaggaggtggtgcccttcctggccaggctcagcaacaggctaagcacatgtcatattgaaggtgatgacctgcatatccagaggaatgtgcaaaagctgaaggacacagtgaaaaagcttggagagagtggagagatcaaagcaattggagaactggatttgctgtttatgtctctgagaaatgcctgcatttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - neurotrophin 3 - interleukin 20 - interleukin 25 - homeobox D10 |