Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GDNF-glial cell derived neurotrophic factor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GDNF-glial cell derived neurotrophic factor Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069369 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GDNF |
| Origin species: | Human |
| Product name: | GDNF-glial cell derived neurotrophic factor Gene |
| Size: | 2ug |
| Accessions: | BC069369 |
| Gene id: | 2668 |
| Gene description: | glial cell derived neurotrophic factor |
| Synonyms: | HFB1-GDNF; ATF; ATF1; ATF2; HSCR3; glial cell line-derived neurotrophic factor; astrocyte-derived trophic factor; glial cell derived neurotrophic factor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagttatgggatgtcgtggctgtctgcctggtgctgctccacaccgcgtccgccttcccgctgcccgccggtaagaggcctcccgaggcgcccgccgaagaccgctccctcggccgccgccgcgcgcccttcgcgctgagcagtgactcaaatatgccagaggattatcctgatcagttcgatgatgtcatggattttattcaagccaccattaaaagactgaaaaggtcaccagataaacaaatggcagtgcttcctagaagagagcggaatcggcaggctgcagctgccaacccagagaattccagaggaaaaggtcggagaggccagaggggcaaaaaccggggttgtgtcttaactgcaatacatttaaatgtcactgacttgggtctgggctatgaaaccaaggaggaactgatttttaggtactgcagcggctcttgcgatgcagctgagacaacgtacgacaaaatattgaaaaacttatccagaaatagaaggctggtgagtgacaaagtagggcaggcatgttgcagacccatcgcctttgatgatgacctgtcgtttttagatgataacctggtttaccatattctaagaaagcattccgctaaaaggtgtggatgtatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chemokine (C-C motif) receptor-like 1 - tigger transposable element derived 7 - peptidoglycan recognition protein 3 - peptidoglycan recognition protein 3 |