Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CALCA-calcitonin-related polypeptide alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CALCA-calcitonin-related polypeptide alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069760 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CALCA |
| Origin species: | Human |
| Product name: | CALCA-calcitonin-related polypeptide alpha Gene |
| Size: | 2ug |
| Accessions: | BC069760 |
| Gene id: | 796 |
| Gene description: | calcitonin-related polypeptide alpha |
| Synonyms: | CALC1; CGRP; CGRP-I; CGRP1; PCT; calcitonin gene-related peptide 1; alpha-type CGRP; calcitonin 1; calcitonin gene-related peptide I; calcitonin/calcitonin-related polypeptide, alpha; katacalcin; calcitonin related polypeptide alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcttccaaaagttctcccccttcctggctctcagcatcttggtcctgttgcaggcaggcagcctccatgcagcaccattcaggtctgccctggagagcagcccagcagacccggccacgctcagtgaggacgaagcgcgcctcctgctggctgcactggtgcaggactatgtgcagatgaaggccagtgagctggagcaggagcaagagagagagggctccagcctggacagccccagatctaagcggtgcggtaatctgagtacttgcatgctgggcacatacacgcaggacttcaacaagtttcacacgttcccccaaactgcaattggggttggagcacctggaaagaaaagggatatgtccagcgacttggagagagaccatcgccctcatgttagcatgccccagaatgccaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 5 open reading frame 20 - solute carrier family 38, member 4 - chromosome 18 open reading frame 1 - chromosome 2 open reading frame 30 |