Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DEFA1-defensin, alpha 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DEFA1-defensin, alpha 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC069423 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DEFA1 |
| Origin species: | Human |
| Product name: | DEFA1-defensin, alpha 1 Gene |
| Size: | 2ug |
| Accessions: | BC069423 |
| Gene id: | 1667 |
| Gene description: | defensin, alpha 1 |
| Synonyms: | DEF1; DEFA2; HNP-1; HP-1; HP1; MRS; neutrophil defensin 1; defensin, alpha 1, myeloid-related sequence; defensin, alpha 2; myeloid-related sequence; defensin alpha 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggaccctcgccatccttgctgccattctcctggtggccctgcaggcccaggctgagccactccaggcaagagctgatgaggttgctgcagccccggagcagattgcagcggacatcccagaagtggttgtttcccttgcatgggacgaaagcttggctccaaagcatccaggctcaaggaaaaacatggcctgctattgcagaataccagcgtgcattgcaggagaacgtcgctatggaacctgcatctaccagggaagactctgggcattctgctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - F-box protein 38 - EPH receptor A10 - F-box protein 42 - KIAA0895-like |