Login to display prices
Login to display prices
SNAP47-synaptosomal-associated protein, 47kDa Gene View larger

SNAP47-synaptosomal-associated protein, 47kDa Gene

PTXBC018760

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNAP47-synaptosomal-associated protein, 47kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNAP47-synaptosomal-associated protein, 47kDa Gene

Proteogenix catalog: PTXBC018760
Ncbi symbol: SNAP47
Product name: SNAP47-synaptosomal-associated protein, 47kDa Gene
Size: 2ug
Accessions: BC018760
Gene id: 116841
Gene description: synaptosomal-associated protein, 47kDa
Synonyms: C1orf142; ESFI5812; HEL-S-290; HEL170; SNAP-47; SVAP1; synaptosomal-associated protein 47; epididymis luminal protein 170; epididymis secretory protein Li 290; synaptosomal-associated 47 kDa protein; synaptosomal-associated protein, 47kDa; synaptosome associated protein 47kDa; synaptosome associated protein 47
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgcgcggctcgccgcggtcttcactgcgcaggcgccgagcggccgaggcgccgcggtcggctctgggactcgtctggcgtccctcagaggcagaagaggcctggaccttggcgcacacagacccaggaacagatgagcagggatgtctgcatccacacctggccgtgcacctactacctggagcccaagaggcgatgggttactggacagctgtccttaacatcgctgtcgctcaggttcatgactgacagcactggagagattctggtcagcttccccctctccagcatagttgagatcaagaaggaggcttcacattttatcttcagctccatcaccatcctggagaagggccatgccaagcactggttcagctccctgcggccaagtcgaaatgtggtcttcagcatcatcgagcatttctggagggagctgctgctgtctcagcctggagccgtggcagacgcatctgtcccaaggacccggggcgaggagctgacgggactcatggctggatcccagaaacgcctggaggacacggcgagggtcctgcaccaccagggccagcagctggacagcgtcatgagaggcctggacaagatggagtcagacctggaggtggcggacagattgctgacagaactggaatctcctgcttggtggccctttagctccaagctttggaagacaccaccggaaacaaagcccagggaagatgtctccatgaccagttgtgaaccctttgggaaagaagggatactgataaaaattcctgctgttatttcccacagaacagagtctcacgttaaaccagggaggctcaccgtccttgtgtctgggttggaaatacatgactccagttctttgctcatgcacaggtttgaaagagaagacgtggacgacatcaaggtccactcaccttacgaaattagcatccgccagcggtttattggaaagccagacatggcctatcgtttgatatctgccaagatgccagaggttatccccattttagaagtgcagttcagcaagaagatggagctgttagaagatgcattggtgctcagaagcgcaagaacctcttcccccgcagagaagagctgctcagtctggcatgcagcatctgggctgatgggctgtaccctgcaccgtgagccacccgcaggagaccaggagggcacagcactgcacctgcagacaagcctgccagccctttctgaggcagatacccaggaactaacccagatcctgaggaggatgaaggggctggccctggaggccgagagtgagctggagagacaagacgaagccctggatggcgttgcagcagctgtggacagggcaaccttgaccatcgacaagcacaacaggcggatgaagaggctgacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: