C20orf112-chromosome 20 open reading frame 112 Gene View larger

C20orf112-chromosome 20 open reading frame 112 Gene

PTXBC065370

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf112-chromosome 20 open reading frame 112 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf112-chromosome 20 open reading frame 112 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC065370
Product type: DNA & cDNA
Ncbi symbol: C20orf112
Origin species: Human
Product name: C20orf112-chromosome 20 open reading frame 112 Gene
Size: 2ug
Accessions: BC065370
Gene id: 140688
Gene description: chromosome 20 open reading frame 112
Synonyms: C20orf112; C20orf113; dJ1184F4.2; dJ1184F4.4; nucleolar protein 4-like; nucleolar protein 4 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcgactccacatggatgtcagctgacccgcacctggcctccagcctgagccccagccaggacgagaggatgcggagcccgcagaacctccacagtcaagaggacgatgactcctcctctgagagtggcagcggcaatggctcctccaccctgaacccatccacgtcgagcagcacgcagggcgaccctgccttccccgagatgaatggcaacggcgccgtggcccccatggacttcaccacggccgccgaggatcagcccatcaacctgtgtgacaagctcccgccggccacggcacttggcacagcctcctacccctcggatggctgcggtgccgacgggctgcggagccgcgtcaaatacggggtgaagaccacccccgagtcccccccctacagctctgggagctacgattccatcaagaccgaggtcagcggctgccctgaggacctgacagtgggccgggccccgacggcagatgatgacgacgatgaccacgatgaccatgaggacaatgacaagatgaacgactctgaaggcatggaccctgagcgtcttaaggccttcaacatgtttgtgcgtctctttgtggacgagaacctggaccgcatggtgcccatctccaagcagcccaaggagaagatccaggccatcatcgagtcctgcagccggcagttccctgagttccaggagcgggcccgcaagcgcatccgcacgtacctcaagtcctgccgtcgcatgaagaagaacggcatggagatgaccagacccacgccaccccatctgacctcggccatggcagaaaacatcctggcagctgcctgtgagagcgagacaagaaaggcagccaagcggatgcgtctagagatctaccagtcctcacaggatgagcccatagccctggacaagcagcactcgcgggactccgcagccatcacccactccacctactcactgccagcctcctcctactcccaggaccctgtgtacgccaacggcggcctcaactacagttaccgcgggtacggggccttgagcagcaacctgcagccccctgcctccctccaaacaggaaaccacagtaatgggcccacggacctcagcatgaaaggcggggcctctaccacctccaccacccccagcgccttgtcgggggagcccccaacaaggcgctggggctgcagctctgtttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - arachidonate 12-lipoxygenase, 12R type
- fatty acid binding protein 2, intestinal
- gamma-glutamyltransferase light chain 2
- cholinergic receptor, nicotinic, beta 3

Buy C20orf112-chromosome 20 open reading frame 112 Gene now

Add to cart