CPA4-carboxypeptidase A4 Gene View larger

CPA4-carboxypeptidase A4 Gene

PTXBC052289

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CPA4-carboxypeptidase A4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CPA4-carboxypeptidase A4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC052289
Product type: DNA & cDNA
Ncbi symbol: CPA4
Origin species: Human
Product name: CPA4-carboxypeptidase A4 Gene
Size: 2ug
Accessions: BC052289
Gene id: 51200
Gene description: carboxypeptidase A4
Synonyms: CPA3; carboxypeptidase A4; carboxypeptidase A3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggtggatactgttcattggggcccttattgggtccagcatctgtggccaagaaaaattttttggggaccaagttttgaggattaatgtcagaaatggagacgagatcagcaaattgagtcaactagtgaattcaaacaacttgaagctcaatttctggaaatctccctcctccttcaatcggcctgtggatgtcctggtcccatctgtcagtctgcaggcatttaaatccttcctgagatcccagggcttagagtacgcagtgacaattgaggacctgcaggcccttttagacaatgaagatgatgaaatgcaacacaatgaagggcaagaacggagcagtaataacttcaactacggggcttaccattccctggaagctatttaccacgagatggacaacattgccgcagactttcctgacctggcgaggagggtgaagattggacattcgtttgaaaaccggccgatgtatgtactgaagttcagcactgggaaaggcgtgaggcggccggccgtttggctgaatgcaggcatccattcccgagagtggatctcccaggccactgcaatctggacggcaaggaagattgtatctgattaccagagggatccagctatcacctccatcttggagaaaatggatattttcttgttgcctgtggccaatcctgatggatatgtgtatactcaaactcaaaaccgattatggaggaagacgcggtcccgaaatcctggaagctcctgcattggtgctgacccaaatagaaactggaacgctagttttgcaggaaagggagccagcgacaacccttgctccgaagtgtaccatggaccccacgccaattcggaagtggaggtgaaatcagtggtagatttcatccaaaaacatgggaatttcaagggcttcatcgacctgcacagctactcgcagctgctgatgtatccatatgggtactcagtcaaaaaggccccagatgccgaggaactcgacaaggtggcgaggcttgcggccaaagctctggcttctgtgtcgggcactgagtaccaagtgggtcccacctgcaccactgtctatccagctagcgggagcagcatcgactgggcgtatgacaacggcatcaaatttgcattcacatttgagttgagagataccgggacttatggcttcctcctgccagctaaccagatcatccccactgcagaggagacgtggctggggctgaagaccatcatggagcatgtgcgggacaacctctactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD200 receptor 1
- MAS1 oncogene-like
- RAD50 interactor 1
- praja ring finger 1

Buy CPA4-carboxypeptidase A4 Gene now

Add to cart