Cart 2 Product Products 402,40 € (empty)
-
1 x C1orf124-c...113,40 € -
No products
To be determined Shipping
402,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 402,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 402,40 €
Data sheet of CTSZ-cathepsin Z Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CTSZ-cathepsin Z Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC042168 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CTSZ |
| Origin species: | Human |
| Product name: | CTSZ-cathepsin Z Gene |
| Size: | 2ug |
| Accessions: | BC042168 |
| Gene id: | 1522 |
| Gene description: | cathepsin Z |
| Synonyms: | CTSX; cathepsin Z; carboxypeptidase LB; cathepsin B2; cathepsin IV; cathepsin P; cathepsin X; cathepsin Y; cathepsin Z1; cysteine-type carboxypeptidase; lysosomal carboxypeptidase B; preprocathepsin P |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgaggcgcgggccagggtggcggccgcttctgctgctcgtgctgctggcgggcgcggcgcagggcggcctctacttccgccggggacagacctgctaccggcctctgcggggggacgggctggctccgctggggcgcagcacatacccccggcctcatgagtacctgtccccagcggatctgcccaagagctgggactggcgcaatgtggatggtgtcaactatgccagcatcacccggaaccagcacatcccccaatactgcggctcctgctgggcccacgccagcaccagcgctatggcggatcggatcaacatcaagaggaagggagcgtggccctccaccctcctgtccgtgcagaacgtcatcgactgcggtaacgctggctcctgtgaagggggtaatgacctgtccgtgtgggactacgcccaccagcacggcatccctgacgagacctgcaacaactaccaggccaaggaccaggagtgtgacaagtttaaccaatgtgggacatgcaatgaattcaaagagtgccacgccatccggaactacaccctctggagggtgggagactacggctccctctctgggagggagaagatgatggcagaaatctacgcaaatggtcccatcagctgtggaataatggcaacagaaagactggctaactacaccggaggcatctatgccgaataccaggacaccacatatataaaccatgtcgtttctgtggctgggtggggcatcagtgatgggactgagtactggattgtccggaattcatggggtgaaccatggggcgagagaggctggctgaggatcgtgaccagcacctataaggatgggaagggcgccagatacaaccttgccatcgaggagcactgtacatttggggaccccatcgtttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - annexin A2 - keratin 80 - secernin 2 - KIT ligand |