Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TCL6-T-cell leukemia/lymphoma 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TCL6-T-cell leukemia/lymphoma 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC041075 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TCL6 |
| Origin species: | Human |
| Product name: | TCL6-T-cell leukemia/lymphoma 6 Gene |
| Size: | 2ug |
| Accessions: | BC041075 |
| Gene id: | 27004 |
| Gene description: | T-cell leukemia/lymphoma 6 |
| Synonyms: | TNG1; TNG2; T-cell leukemia/lymphoma 6 (non-protein coding) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcccagagtgacacagaggaagaggcccctggatggatgcatggggaagatcacgggaattacaagtgacatcctgaagtatgatcacaaatgtttcaaattaagccttcctgctaagtttccagaggtgtgtggctcggacgaagtgtttccagaccctgatctactgcatgtcctgcctgttgctggttctttgcagcagtccattgaccaatgctgtctacagcttgagagcctctgcaggccagggctgctctgtgcacatcctacgttactattcaaactgcacagcagcatgaaaaacaggcccttcttttctctcatttacacatatgtgaagaagacacagcaagtgagaaaacgtgaccgaaagccacgcggacaggtggccgcagggccaaacccaacttccgtgatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nucleolar protein 7, 27kDa - ectodysplasin A2 receptor - NADPH oxidase activator 1 - methyltransferase like 3 |