Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SPANXC-SPANX family, member C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPANXC-SPANX family, member C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC054023 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPANXC |
| Origin species: | Human |
| Product name: | SPANXC-SPANX family, member C Gene |
| Size: | 2ug |
| Accessions: | BC054023 |
| Gene id: | 64663 |
| Gene description: | SPANX family, member C |
| Synonyms: | CT11.3; SPANX-C; sperm protein associated with the nucleus on the X chromosome C; SPAN-Xc protein; cancer-testis-associated protein CTp11; cancer/testis antigen 11.3; cancer/testis antigen family 11, member 3; cancer/testis-associated protein of 11 kD; nuclear-associated protein SPAN-Xc; sperm protein associated with the nucleus, X chromosome, family member C; SPANX family member C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacaaacaatccagtgccggcggggtgaagaggagcgtcccctgtgaatccaacgaggtgaatgagacgatgccggagaccccaactggggactcagacccgcaacctgctcctaaaaaaatgaaaacatctgagtcctcgaccatactagtggttcgctacaggaggaacgtgaaaagaacatctccagaggaactgctgaatgaccacgcccgagagaacagaatcaaccccctccaaatggaggaggaggaattcatggaaataatggttgaaatacctgcaaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glutathione peroxidase 1 - bromodomain containing 9 - mutS homolog 5 (E. coli) - dynamin binding protein |