No products
Prices are tax excluded
PTXBC062707
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062707 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIMM23 |
| Origin species: | Human |
| Product name: | TIMM23-translocase of inner mitochondrial membrane 23 homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC062707 |
| Gene id: | 10431 |
| Gene description: | translocase of inner mitochondrial membrane 23 homolog (yeast) |
| Synonyms: | Tim23; mitochondrial import inner membrane translocase subunit Tim23; translocase of inner mitochondrial membrane 23 homolog; translocase of inner mitochondrial membrane 23 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaggaggcgggggaagcggcaacaaaaccacagggggattggccggctttttcggagccggcggagcaggttactcgcacgcggatttggctggcgtcccgctaactggtatgaaccctctgtctccttatttaaatgtggatccacgatacctcgtgcaggatacagatgagtttatacctaccggagctaataaaacccggggcagatttgagctggccttctttacgattggaggatgttgcatgacaggggctgcgtttggtgcaatgaatggtcttcggctaggattgaaggaaacccagaacatggcctggtccaaaccaagaaatgtacagattttgaatatggtgactaggcaaggggcactttgggctaatactctaggttctctggctttgctctatagtgcatttggtgtcatcattgagaaaacacgaggtgcagaagatgaccttaacacagtagcagctggaaccatgacaggcatgttgtataaatgtacaggtggtcttcgagggatagcacgaggtggtctgacaggactaacacttaccagcctctatgcactatataataactgggagcacatgaaaggctccttgctccaacagtcactctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) activator subunit 2 (PA28 beta) - PAN2 polyA specific ribonuclease subunit homolog (S. cerevisiae) - serpin peptidase inhibitor, clade G (C1 inhibitor), member 1 - membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) |