Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CAMP-cathelicidin antimicrobial peptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CAMP-cathelicidin antimicrobial peptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC055089 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CAMP |
| Origin species: | Human |
| Product name: | CAMP-cathelicidin antimicrobial peptide Gene |
| Size: | 2ug |
| Accessions: | BC055089 |
| Gene id: | 820 |
| Gene description: | cathelicidin antimicrobial peptide |
| Synonyms: | CAP-18; CAP18; CRAMP; FALL-39; FALL39; HSD26; LL37; cathelicidin antimicrobial peptide; 18 kDa cationic antimicrobial protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagacccaaagggatggccactccctggggcggtggtcactggtgctcctgctgctgggcctggtgatgcctctggccatcattgcccaggtcctcagctacaaggaagctgtgcttcgtgctatagatggcatcaaccagcggtcctcggatgctaacctctaccgcctcctggacctggaccccaggcccacgatggatggggacccagacacgccaaagcctgtgagcttcacagtgaaggagacagtgtgccccaggacgacacagcagtcaccagaggattgtgacttcaagaaggacgggctggtgaagcggtgtatggggacagtgaccctcaaccaggccaggggctcctttgacatcagttgtgataaggataacaagagatttgccctgctgggtgatttcttccggaaatctaaagagaagattggcaaagagtttaaaagaattgtccagagaatcaaggattttttgcggaatcttgtacccaggacagagtcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAB4B, member RAS oncogene family - TIMP metallopeptidase inhibitor 2 - oxysterol binding protein-like 6 - eyes absent homolog 4 (Drosophila) |